Incidental Mutation 'R5598:Olfr56'
ID437932
Institutional Source Beutler Lab
Gene Symbol Olfr56
Ensembl Gene ENSMUSG00000040328
Gene Nameolfactory receptor 56
SynonymsIF7, MOR276-1, GA_x6K02T2QP88-6300500-6299553
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48978889-49135387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 49135114 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 307 (D307E)
Ref Sequence ENSEMBL: ENSMUSP00000144951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
AA Change: D275E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328
AA Change: D275E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
AA Change: D275E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328
AA Change: D275E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
AA Change: D275E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328
AA Change: D275E

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
AA Change: D307E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328
AA Change: D307E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203810
AA Change: D307E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328
AA Change: D307E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Olfr56
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4354001:Olfr56 UTSW 11 49134305 missense probably damaging 1.00
R0200:Olfr56 UTSW 11 49135047 missense probably damaging 0.99
R0540:Olfr56 UTSW 11 49134722 missense probably damaging 1.00
R0607:Olfr56 UTSW 11 49134722 missense probably damaging 1.00
R4877:Olfr56 UTSW 11 49134781 missense probably damaging 1.00
R5027:Olfr56 UTSW 11 49134624 missense probably benign 0.35
R5952:Olfr56 UTSW 11 49134572 missense probably damaging 1.00
R6191:Olfr56 UTSW 11 49135050 missense probably damaging 1.00
R6475:Olfr56 UTSW 11 49134933 missense probably benign 0.01
R6565:Olfr56 UTSW 11 49134812 missense probably damaging 0.99
R6807:Olfr56 UTSW 11 49134978 missense probably damaging 1.00
R7228:Olfr56 UTSW 11 49134879 missense possibly damaging 0.52
R7792:Olfr56 UTSW 11 49134669 missense possibly damaging 0.95
R8255:Olfr56 UTSW 11 49134480 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCTATGCTCGCATCTTGGG -3'
(R):5'- GGTCCCTTCAAAATCCTTGTG -3'

Sequencing Primer
(F):5'- CGTATGCACTCTGCCCAG -3'
(R):5'- CCCTTCAAAATCCTTGTGGTAAAGGG -3'
Posted On2016-10-26