Incidental Mutation 'R5598:Atp13a5'
ID437942
Institutional Source Beutler Lab
Gene Symbol Atp13a5
Ensembl Gene ENSMUSG00000048939
Gene NameATPase type 13A5
SynonymsC630015F21Rik
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location29231851-29378732 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 29257077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000142681] [ENSMUST00000143373]
Predicted Effect probably benign
Transcript: ENSMUST00000075806
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142681
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143373
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a decreased mean percentage of natural killer cells when compared with controls. Male homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Atp13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp13a5 APN 16 29267014 nonsense probably null
IGL00583:Atp13a5 APN 16 29275453 splice site probably benign
IGL01472:Atp13a5 APN 16 29275423 missense probably damaging 1.00
IGL01473:Atp13a5 APN 16 29316724 missense probably damaging 1.00
IGL02142:Atp13a5 APN 16 29234563 missense probably benign 0.01
IGL02346:Atp13a5 APN 16 29327736 nonsense probably null
IGL02454:Atp13a5 APN 16 29232808 missense probably benign 0.35
IGL02557:Atp13a5 APN 16 29248182 missense probably benign 0.24
IGL02651:Atp13a5 APN 16 29334091 splice site probably benign
IGL02697:Atp13a5 APN 16 29348532 missense probably benign
IGL02704:Atp13a5 APN 16 29251328 nonsense probably null
IGL02993:Atp13a5 APN 16 29293504 nonsense probably null
IGL03329:Atp13a5 APN 16 29334065 nonsense probably null
IGL03346:Atp13a5 APN 16 29314604 missense probably benign 0.15
IGL03493:Atp13a5 APN 16 29297524 missense probably benign
PIT4810001:Atp13a5 UTSW 16 29314564 missense probably damaging 1.00
R0356:Atp13a5 UTSW 16 29348755 splice site probably benign
R0393:Atp13a5 UTSW 16 29266929 splice site probably benign
R0456:Atp13a5 UTSW 16 29232740 missense probably benign 0.03
R0526:Atp13a5 UTSW 16 29348740 missense probably damaging 0.97
R0632:Atp13a5 UTSW 16 29298208 missense probably benign 0.00
R0674:Atp13a5 UTSW 16 29248350 splice site probably benign
R1417:Atp13a5 UTSW 16 29298235 missense probably benign 0.00
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1515:Atp13a5 UTSW 16 29333974 missense probably benign 0.23
R1659:Atp13a5 UTSW 16 29293433 missense probably benign
R1723:Atp13a5 UTSW 16 29232799 missense possibly damaging 0.88
R1779:Atp13a5 UTSW 16 29314660 missense possibly damaging 0.67
R1794:Atp13a5 UTSW 16 29321709 missense probably damaging 1.00
R1958:Atp13a5 UTSW 16 29314601 missense probably damaging 1.00
R2218:Atp13a5 UTSW 16 29321646 missense probably damaging 0.99
R2282:Atp13a5 UTSW 16 29237321 missense probably damaging 1.00
R2356:Atp13a5 UTSW 16 29281069 missense probably damaging 1.00
R2365:Atp13a5 UTSW 16 29251256 missense probably benign 0.00
R2497:Atp13a5 UTSW 16 29339071 nonsense probably null
R2517:Atp13a5 UTSW 16 29297397 missense possibly damaging 0.79
R3552:Atp13a5 UTSW 16 29310766 missense probably damaging 1.00
R3685:Atp13a5 UTSW 16 29316755 missense probably damaging 1.00
R3957:Atp13a5 UTSW 16 29298194 missense probably benign 0.01
R4433:Atp13a5 UTSW 16 29282024 missense probably damaging 0.99
R4503:Atp13a5 UTSW 16 29293528 missense probably benign 0.37
R4579:Atp13a5 UTSW 16 29248338 critical splice acceptor site probably null
R4632:Atp13a5 UTSW 16 29348719 missense probably damaging 1.00
R4718:Atp13a5 UTSW 16 29248170 missense probably damaging 1.00
R4865:Atp13a5 UTSW 16 29248160 missense probably damaging 0.98
R4899:Atp13a5 UTSW 16 29378500 missense probably damaging 1.00
R4909:Atp13a5 UTSW 16 29334028 missense possibly damaging 0.81
R5011:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5013:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5032:Atp13a5 UTSW 16 29263450 missense probably damaging 1.00
R5226:Atp13a5 UTSW 16 29248279 missense probably damaging 1.00
R5485:Atp13a5 UTSW 16 29281942 critical splice donor site probably null
R5945:Atp13a5 UTSW 16 29237243 missense probably benign 0.06
R5958:Atp13a5 UTSW 16 29339042 missense probably damaging 1.00
R6194:Atp13a5 UTSW 16 29308239 missense probably damaging 1.00
R6214:Atp13a5 UTSW 16 29251407 missense probably damaging 1.00
R6273:Atp13a5 UTSW 16 29348737 missense probably benign 0.10
R6376:Atp13a5 UTSW 16 29237252 missense probably benign 0.00
R6431:Atp13a5 UTSW 16 29251402 missense possibly damaging 0.93
R6495:Atp13a5 UTSW 16 29321622 critical splice donor site probably null
R6619:Atp13a5 UTSW 16 29349015 missense probably benign 0.05
R6853:Atp13a5 UTSW 16 29321662 missense possibly damaging 0.94
R6932:Atp13a5 UTSW 16 29281951 missense probably damaging 1.00
R7070:Atp13a5 UTSW 16 29334061 missense possibly damaging 0.88
R7343:Atp13a5 UTSW 16 29321749 missense probably benign 0.01
R7425:Atp13a5 UTSW 16 29297460 nonsense probably null
R7570:Atp13a5 UTSW 16 29266963 missense probably damaging 1.00
R7781:Atp13a5 UTSW 16 29297408 missense probably benign 0.00
R7876:Atp13a5 UTSW 16 29321748 missense possibly damaging 0.93
R7959:Atp13a5 UTSW 16 29321748 missense possibly damaging 0.93
X0023:Atp13a5 UTSW 16 29310782 missense probably damaging 1.00
Z1088:Atp13a5 UTSW 16 29282062 missense probably benign 0.06
Z1177:Atp13a5 UTSW 16 29280969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAAGGTCACTGCCACTTG -3'
(R):5'- GGGTCTCTTTATTCCCAAGCAG -3'

Sequencing Primer
(F):5'- AGGTCACTGCCACTTGATGAG -3'
(R):5'- TTATTCCCAAGCAGCCATCC -3'
Posted On2016-10-26