Incidental Mutation 'R5598:Nhlrc4'
ID437946
Institutional Source Beutler Lab
Gene Symbol Nhlrc4
Ensembl Gene ENSMUSG00000090113
Gene NameNHL repeat containing 4
Synonyms
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5598 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25942233-25944961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25943492 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 94 (P94S)
Ref Sequence ENSEMBL: ENSMUSP00000082102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026823] [ENSMUST00000085027] [ENSMUST00000097368] [ENSMUST00000139226] [ENSMUST00000140304] [ENSMUST00000145745] [ENSMUST00000148307] [ENSMUST00000148382] [ENSMUST00000162431] [ENSMUST00000208043] [ENSMUST00000208071]
Predicted Effect probably benign
Transcript: ENSMUST00000026823
SMART Domains Protein: ENSMUSP00000026823
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Pfam:Gpi1 274 463 5.1e-79 PFAM
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085027
AA Change: P94S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082102
Gene: ENSMUSG00000090113
AA Change: P94S

DomainStartEndE-ValueType
Pfam:NHL 61 88 8.4e-8 PFAM
SCOP:d1crua_ 89 129 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097368
SMART Domains Protein: ENSMUSP00000094981
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Pfam:Gpi1 365 523 8.6e-66 PFAM
transmembrane domain 538 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124032
Predicted Effect probably benign
Transcript: ENSMUST00000139226
SMART Domains Protein: ENSMUSP00000115447
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140304
Predicted Effect probably benign
Transcript: ENSMUST00000145745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148045
Predicted Effect probably benign
Transcript: ENSMUST00000148307
Predicted Effect probably benign
Transcript: ENSMUST00000148382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162078
Predicted Effect probably benign
Transcript: ENSMUST00000162431
SMART Domains Protein: ENSMUSP00000125106
Gene: ENSMUSG00000025727

DomainStartEndE-ValueType
Pfam:zf-C2H2_7 17 70 4.3e-40 PFAM
low complexity region 77 90 N/A INTRINSIC
low complexity region 117 137 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably benign
Transcript: ENSMUST00000208043
Predicted Effect probably benign
Transcript: ENSMUST00000208071
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Nhlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Nhlrc4 APN 17 25943361 makesense probably null
R0690:Nhlrc4 UTSW 17 25943684 missense probably damaging 1.00
R3771:Nhlrc4 UTSW 17 25943393 nonsense probably null
R3773:Nhlrc4 UTSW 17 25943393 nonsense probably null
R4740:Nhlrc4 UTSW 17 25943603 missense probably benign 0.28
R5930:Nhlrc4 UTSW 17 25943719 missense probably benign 0.03
R6873:Nhlrc4 UTSW 17 25943522 nonsense probably null
Z1176:Nhlrc4 UTSW 17 25943744 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTATCAGGAAGACGGCTCAG -3'
(R):5'- AGAGTTTGGGGATGTACAGC -3'

Sequencing Primer
(F):5'- TTCCATGATAGTACAAAGGACTCAGG -3'
(R):5'- ACAGCTGTTTGGCAGTGC -3'
Posted On2016-10-26