Incidental Mutation 'R5598:Lgi1'
ID437950
Institutional Source Beutler Lab
Gene Symbol Lgi1
Ensembl Gene ENSMUSG00000067242
Gene Nameleucine-rich repeat LGI family, member 1
Synonyms
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R5598 (G1)
Quality Score222
Status Not validated
Chromosome19
Chromosomal Location38264536-38312214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38306181 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000143128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087252] [ENSMUST00000196090] [ENSMUST00000198045] [ENSMUST00000198518] [ENSMUST00000199812]
Predicted Effect probably benign
Transcript: ENSMUST00000087252
SMART Domains Protein: ENSMUSP00000084507
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 225 266 3.8e-9 PFAM
Pfam:EPTP 271 312 6.5e-12 PFAM
Pfam:EPTP 317 363 7.2e-16 PFAM
Pfam:EPTP 366 414 1.4e-7 PFAM
Pfam:EPTP 419 461 1.6e-12 PFAM
Pfam:EPTP 464 505 7.7e-11 PFAM
Pfam:EPTP 510 550 3.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130039
SMART Domains Protein: ENSMUSP00000117936
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
LRR 51 74 2.61e2 SMART
LRR_TYP 75 98 5.14e-3 SMART
LRR_TYP 99 122 2.27e-4 SMART
LRRCT 131 180 4.63e-6 SMART
Pfam:EPTP 182 218 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196090
AA Change: D419G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143538
Gene: ENSMUSG00000067242
AA Change: D419G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 3.3e-4 SMART
LRRCT 125 174 2.3e-8 SMART
Pfam:EPTP 177 218 3.1e-6 PFAM
Pfam:EPTP 223 264 5.3e-9 PFAM
Pfam:EPTP 269 315 5.8e-13 PFAM
Pfam:EPTP 318 366 1.1e-4 PFAM
Pfam:EPTP 371 413 1.3e-9 PFAM
Pfam:EPTP 416 457 6.2e-8 PFAM
Pfam:EPTP 462 502 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198045
SMART Domains Protein: ENSMUSP00000143292
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
LRR 90 113 1.1e0 SMART
LRR_TYP 114 137 2.1e-5 SMART
LRR_TYP 138 161 9.2e-7 SMART
LRRCT 173 222 2.3e-8 SMART
Pfam:EPTP 224 267 2.8e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198518
AA Change: D467G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143128
Gene: ENSMUSG00000067242
AA Change: D467G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 224 267 8.3e-15 PFAM
Pfam:EPTP 270 313 9.4e-16 PFAM
Pfam:EPTP 316 364 3.3e-18 PFAM
Pfam:EPTP 365 415 5.2e-8 PFAM
Pfam:EPTP 418 462 1e-16 PFAM
Pfam:EPTP 463 506 1.9e-15 PFAM
Pfam:EPTP 509 550 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199812
AA Change: D443G

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143502
Gene: ENSMUSG00000067242
AA Change: D443G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 2.2e-5 SMART
LRR_TYP 114 137 9.4e-7 SMART
LRRCT 149 198 2.3e-8 SMART
Pfam:EPTP 201 242 3.2e-6 PFAM
Pfam:EPTP 247 288 5.6e-9 PFAM
Pfam:EPTP 293 339 6.1e-13 PFAM
Pfam:EPTP 342 390 1.2e-4 PFAM
Pfam:EPTP 395 437 1.4e-9 PFAM
Pfam:EPTP 440 481 6.6e-8 PFAM
Pfam:EPTP 486 526 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200561
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the secreted leucine-rich repeat (LRR) superfamily and shares homology with members of the SLIT protein family. The encoded protein may regulate the activity of voltage-gated potassium channels and may be involved in neuronal growth regulation and cell survival. This gene is rearranged as a result of translocations in glioblastoma cell lines, and it is frequently down-regulated or rearranged in malignant gliomas. Mutations in this gene result in autosomal dominant lateral temporal epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, seizures, and death by the third week of life. Mice heterozygous for this allele exhibit increased suseptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Tmco4 A G 4: 139,053,905 D460G probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Lgi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Lgi1 APN 19 38284005 missense probably benign 0.24
IGL03112:Lgi1 APN 19 38284030 missense possibly damaging 0.84
R0201:Lgi1 UTSW 19 38301293 missense possibly damaging 0.92
R1573:Lgi1 UTSW 19 38284181 missense probably benign 0.30
R1795:Lgi1 UTSW 19 38306183 missense probably benign
R2010:Lgi1 UTSW 19 38301235 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3733:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R4643:Lgi1 UTSW 19 38300710 missense probably damaging 1.00
R4678:Lgi1 UTSW 19 38301289 missense probably damaging 1.00
R4814:Lgi1 UTSW 19 38300878 critical splice donor site probably null
R4857:Lgi1 UTSW 19 38306250 missense probably damaging 1.00
R6180:Lgi1 UTSW 19 38264956 missense probably damaging 1.00
R6196:Lgi1 UTSW 19 38305809 missense probably benign 0.23
R6847:Lgi1 UTSW 19 38301290 missense probably damaging 1.00
R7178:Lgi1 UTSW 19 38306285 missense probably damaging 1.00
R7376:Lgi1 UTSW 19 38284020 missense probably damaging 1.00
R7448:Lgi1 UTSW 19 38301265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCCCTCAGAACACCTC -3'
(R):5'- AATGATCTGGGTGCCTGAACG -3'

Sequencing Primer
(F):5'- CGCCCTGTTATTTACCAGTGGAG -3'
(R):5'- GTGCCTGAACGTTTAACTCCTGAAAC -3'
Posted On2016-10-26