Incidental Mutation 'R5609:Slx4ip'
ID437956
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137000242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 29 (D29G)
Ref Sequence ENSEMBL: ENSMUSP00000136131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000141463] [ENSMUST00000180277]
Predicted Effect probably damaging
Transcript: ENSMUST00000028737
AA Change: D29G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281
AA Change: D29G

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099311
AA Change: D29G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: D29G

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135260
Predicted Effect unknown
Transcript: ENSMUST00000141463
AA Change: D45G
Predicted Effect probably damaging
Transcript: ENSMUST00000180277
AA Change: D29G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: D29G

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2263:Slx4ip UTSW 2 137044015 missense probably damaging 1.00
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6391:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6868:Slx4ip UTSW 2 137000210 missense probably damaging 1.00
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
R7214:Slx4ip UTSW 2 137046730 missense probably benign 0.15
R7406:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGAACACTAGGAGCCATG -3'
(R):5'- TCCTGCCTTTCAGTGAACGC -3'

Sequencing Primer
(F):5'- CACTAGGAGCCATGCTGAGATTC -3'
(R):5'- CTCAGAATAGCTGACTAGCTG -3'
Posted On2016-10-26