Incidental Mutation 'R5609:Vmn1r73'
ID437964
Institutional Source Beutler Lab
Gene Symbol Vmn1r73
Ensembl Gene ENSMUSG00000051687
Gene Namevomeronasal 1 receptor 73
SynonymsV1rg2
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location11730266-11762081 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 11756664 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 136 (W136*)
Ref Sequence ENSEMBL: ENSMUSP00000153827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055070] [ENSMUST00000226516]
Predicted Effect probably null
Transcript: ENSMUST00000055070
AA Change: W136*
SMART Domains Protein: ENSMUSP00000055353
Gene: ENSMUSG00000051687
AA Change: W136*

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 7.5e-7 PFAM
Pfam:V1R 32 297 1.9e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226516
AA Change: W136*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Vmn1r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Vmn1r73 APN 7 11756738 missense probably benign 0.02
IGL02337:Vmn1r73 APN 7 11756713 missense possibly damaging 0.69
IGL02666:Vmn1r73 APN 7 11756938 missense probably damaging 1.00
IGL02741:Vmn1r73 APN 7 11756783 missense probably benign 0.05
IGL02756:Vmn1r73 APN 7 11756647 missense possibly damaging 0.95
IGL03113:Vmn1r73 APN 7 11756600 missense probably benign
IGL03195:Vmn1r73 APN 7 11757080 missense probably damaging 1.00
R0023:Vmn1r73 UTSW 7 11757070 missense probably benign 0.43
R0379:Vmn1r73 UTSW 7 11756846 missense probably benign 0.16
R3941:Vmn1r73 UTSW 7 11756755 missense probably damaging 1.00
R4224:Vmn1r73 UTSW 7 11756579 missense probably damaging 0.99
R4631:Vmn1r73 UTSW 7 11756831 missense probably benign 0.22
R4912:Vmn1r73 UTSW 7 11756669 missense probably damaging 0.99
R5060:Vmn1r73 UTSW 7 11756756 missense probably damaging 1.00
R5450:Vmn1r73 UTSW 7 11756449 missense possibly damaging 0.63
R6059:Vmn1r73 UTSW 7 11756611 missense probably benign 0.40
R6508:Vmn1r73 UTSW 7 11756704 missense possibly damaging 0.73
R6967:Vmn1r73 UTSW 7 11756617 nonsense probably null
R7099:Vmn1r73 UTSW 7 11756393 missense probably damaging 1.00
R7304:Vmn1r73 UTSW 7 11756897 missense probably damaging 1.00
R7579:Vmn1r73 UTSW 7 11757155 missense probably benign 0.08
R7891:Vmn1r73 UTSW 7 11757109 missense possibly damaging 0.87
Z1176:Vmn1r73 UTSW 7 11756956 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCATTCCACAGACACTGTTG -3'
(R):5'- TGAGACCCAGACATAGTCCATCAG -3'

Sequencing Primer
(F):5'- CCACAGACACTGTTGAATTATGG -3'
(R):5'- TAGTCCATCAGAGAAACACAGTAAG -3'
Posted On2016-10-26