Incidental Mutation 'R5609:Timp2'
ID437984
Institutional Source Beutler Lab
Gene Symbol Timp2
Ensembl Gene ENSMUSG00000017466
Gene Nametissue inhibitor of metalloproteinase 2
SynonymsTimp-2, D11Bwg1104e, TIMP-2
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118301069-118355740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118320161 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 60 (D60V)
Ref Sequence ENSEMBL: ENSMUSP00000017610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017610] [ENSMUST00000155707]
Predicted Effect probably damaging
Transcript: ENSMUST00000017610
AA Change: D60V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017610
Gene: ENSMUSG00000017466
AA Change: D60V

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
NTR 27 203 1.05e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155707
SMART Domains Protein: ENSMUSP00000122642
Gene: ENSMUSG00000017466

DomainStartEndE-ValueType
NTR 1 126 1.48e-71 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired activation of pro-matrix metalloproteinase-2, but appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Chac1 A G 2: 119,351,406 K2E unknown Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Timp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2508:Timp2 UTSW 11 118310586 missense probably damaging 1.00
R3899:Timp2 UTSW 11 118303716 missense probably damaging 0.99
R3900:Timp2 UTSW 11 118303716 missense probably damaging 0.99
R4366:Timp2 UTSW 11 118310671 missense probably damaging 0.99
R4632:Timp2 UTSW 11 118303772 missense probably benign 0.00
R5496:Timp2 UTSW 11 118303881 missense probably benign 0.00
R5646:Timp2 UTSW 11 118317532 splice site probably null
R7733:Timp2 UTSW 11 118317529 critical splice acceptor site probably null
R7737:Timp2 UTSW 11 118303895 missense probably damaging 1.00
R7808:Timp2 UTSW 11 118303800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTAACATTTCTGCCTGGC -3'
(R):5'- TCCTTGCTTATGACAAGACAGG -3'

Sequencing Primer
(F):5'- ACGTAACATTTCTGCCTGGCTTTTG -3'
(R):5'- GGAGTCTCCTCTGATCCCTC -3'
Posted On2016-10-26