Incidental Mutation 'R0063:Nrcam'
ID43799
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Nameneuronal cell adhesion molecule
SynonymsC030017F07Rik, Bravo, C130076O07Rik
MMRRC Submission 038355-MU
Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0063 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location44328885-44601964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44550028 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 343 (V343F)
Ref Sequence ENSEMBL: ENSMUSP00000106376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000219939] [ENSMUST00000220123]
Predicted Effect probably benign
Transcript: ENSMUST00000020939
AA Change: V343F

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: V343F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110748
AA Change: V343F

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: V343F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219592
Predicted Effect probably benign
Transcript: ENSMUST00000219906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219928
Predicted Effect probably benign
Transcript: ENSMUST00000219939
Predicted Effect probably benign
Transcript: ENSMUST00000220123
AA Change: V349F

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220130
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,861,048 R245* probably null Het
4930563I02Rik T A 14: 60,096,028 probably benign Het
9330182L06Rik T C 5: 9,440,709 probably benign Het
Acss1 T C 2: 150,627,292 T435A probably damaging Het
Aoc2 T A 11: 101,326,071 S327T probably damaging Het
Arid5a T A 1: 36,318,564 Y252N probably damaging Het
AU040320 T C 4: 126,839,672 Y662H probably damaging Het
B4gat1 T A 19: 5,039,707 L244* probably null Het
Bcam C T 7: 19,766,848 V134I probably benign Het
Btbd16 A T 7: 130,823,166 T426S probably benign Het
Btn1a1 C T 13: 23,465,097 probably null Het
Cap2 T C 13: 46,638,032 probably benign Het
Capn8 T A 1: 182,602,112 D299E probably damaging Het
Cdipt G A 7: 126,979,600 V160I probably benign Het
Cep164 A G 9: 45,768,618 S1267P possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col3a1 T C 1: 45,330,541 probably benign Het
Cyb5r3 T C 15: 83,161,936 T60A probably benign Het
Dgkb T G 12: 38,604,113 S744A probably benign Het
Dock2 T A 11: 34,756,284 probably null Het
Ece1 C T 4: 137,948,581 T422M probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Eml3 C A 19: 8,938,478 A644D probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Foxp1 A G 6: 98,944,723 probably benign Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Il17rd G A 14: 27,082,733 C88Y probably damaging Het
Il17rd C A 14: 27,082,734 C88* probably null Het
Ino80c A G 18: 24,106,624 F160S probably damaging Het
Ints8 T C 4: 11,252,857 N75S probably damaging Het
Irf2bp1 C T 7: 19,005,847 R471C possibly damaging Het
Irs1 T A 1: 82,288,859 E545D probably damaging Het
Lama3 T C 18: 12,528,705 probably benign Het
Mast4 C A 13: 103,334,215 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Nat8f2 A T 6: 85,867,833 S182R possibly damaging Het
Opn5 T C 17: 42,596,626 S120G probably damaging Het
Pdk2 T C 11: 95,032,480 H106R probably benign Het
Pkhd1 G A 1: 20,211,950 T2889I probably benign Het
Pkhd1l1 T A 15: 44,529,237 L1656H probably damaging Het
Plxna2 A T 1: 194,644,939 T394S probably benign Het
Pnpla8 T A 12: 44,282,832 C56S probably damaging Het
Prdm8 G T 5: 98,184,594 R118L probably damaging Het
Prkce T C 17: 86,482,111 probably benign Het
Ptprk T A 10: 28,263,767 Y163N probably damaging Het
Rbbp8 T A 18: 11,734,557 probably benign Het
Rnh1 A T 7: 141,164,196 probably null Het
Rtn4 T A 11: 29,705,527 probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc2a2 T C 3: 28,717,440 M173T probably damaging Het
Slc2a8 T A 2: 32,979,999 probably null Het
Tdpoz1 A T 3: 93,670,814 M221K probably benign Het
Tgm7 G T 2: 121,094,096 H533Q probably benign Het
Timm29 C A 9: 21,593,008 A17E probably benign Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tmem89 A G 9: 108,914,812 N60S probably benign Het
Tpx2 A G 2: 152,880,123 T212A probably damaging Het
Trio G T 15: 27,881,437 probably benign Het
Tulp2 T C 7: 45,520,860 probably benign Het
Uggt2 A G 14: 119,007,130 probably benign Het
Vmn2r5 T A 3: 64,503,800 E449V probably benign Het
Vwa8 A G 14: 79,164,216 probably benign Het
Xirp2 A G 2: 67,509,083 D556G probably damaging Het
Xrn1 T C 9: 95,969,535 L202P probably damaging Het
Zfp354a A T 11: 51,069,571 H203L probably damaging Het
Zfp53 A C 17: 21,508,105 R133S probably benign Het
Zfp787 C T 7: 6,132,323 probably null Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44575884 missense probably benign 0.27
IGL01657:Nrcam APN 12 44559800 missense probably damaging 1.00
IGL02434:Nrcam APN 12 44590243 splice site probably benign
IGL02455:Nrcam APN 12 44570530 missense probably damaging 1.00
IGL02712:Nrcam APN 12 44573827 missense probably damaging 1.00
IGL02834:Nrcam APN 12 44541075 critical splice donor site probably null
IGL03022:Nrcam APN 12 44598442 missense probably damaging 1.00
IGL03174:Nrcam APN 12 44576006 splice site probably benign
IGL03389:Nrcam APN 12 44549906 missense probably benign 0.00
IGL03397:Nrcam APN 12 44559757 missense probably damaging 1.00
I2288:Nrcam UTSW 12 44564315 missense probably benign 0.06
I2289:Nrcam UTSW 12 44564315 missense probably benign 0.06
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44584845 missense probably benign 0.00
R0463:Nrcam UTSW 12 44551341 missense probably damaging 1.00
R0590:Nrcam UTSW 12 44564032 missense probably damaging 1.00
R0674:Nrcam UTSW 12 44564322 missense probably benign 0.17
R0930:Nrcam UTSW 12 44549884 missense probably benign
R1241:Nrcam UTSW 12 44590164 missense probably damaging 1.00
R1279:Nrcam UTSW 12 44544877 unclassified probably null
R1523:Nrcam UTSW 12 44572249 missense probably damaging 1.00
R1572:Nrcam UTSW 12 44537364 splice site probably benign
R1629:Nrcam UTSW 12 44563986 missense probably benign 0.00
R1651:Nrcam UTSW 12 44576679 missense probably damaging 0.97
R1729:Nrcam UTSW 12 44573850 missense probably benign
R1739:Nrcam UTSW 12 44571675 missense probably damaging 1.00
R1803:Nrcam UTSW 12 44572208 missense probably benign
R1884:Nrcam UTSW 12 44544755 missense probably damaging 1.00
R1974:Nrcam UTSW 12 44563993 missense probably benign 0.05
R1992:Nrcam UTSW 12 44540970 missense probably damaging 1.00
R2102:Nrcam UTSW 12 44576688 missense probably benign 0.00
R2106:Nrcam UTSW 12 44570290 missense probably benign 0.12
R3854:Nrcam UTSW 12 44575884 missense probably benign 0.27
R4005:Nrcam UTSW 12 44532646 missense probably benign
R4088:Nrcam UTSW 12 44572202 missense possibly damaging 0.93
R4115:Nrcam UTSW 12 44566326 missense possibly damaging 0.87
R4428:Nrcam UTSW 12 44576775 missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44559730 missense probably damaging 1.00
R4580:Nrcam UTSW 12 44562540 critical splice donor site probably null
R4601:Nrcam UTSW 12 44591056 missense probably damaging 1.00
R4688:Nrcam UTSW 12 44547237 missense probably benign
R4825:Nrcam UTSW 12 44575986 nonsense probably null
R4838:Nrcam UTSW 12 44574019 missense probably damaging 1.00
R4950:Nrcam UTSW 12 44598490 missense probably damaging 1.00
R4960:Nrcam UTSW 12 44566299 missense probably benign 0.01
R5081:Nrcam UTSW 12 44570353 missense probably benign 0.00
R5297:Nrcam UTSW 12 44544784 missense probably damaging 1.00
R5504:Nrcam UTSW 12 44564132 critical splice donor site probably null
R5593:Nrcam UTSW 12 44559700 missense probably damaging 1.00
R5654:Nrcam UTSW 12 44564058 missense probably benign
R5691:Nrcam UTSW 12 44564256 missense probably damaging 1.00
R5890:Nrcam UTSW 12 44576771 missense probably benign
R5937:Nrcam UTSW 12 44572291 missense probably benign 0.00
R5980:Nrcam UTSW 12 44571633 missense probably damaging 1.00
R6132:Nrcam UTSW 12 44570224 missense probably damaging 1.00
R6213:Nrcam UTSW 12 44562432 missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44572300 missense probably benign
R6617:Nrcam UTSW 12 44540963 missense probably damaging 1.00
R6666:Nrcam UTSW 12 44571555 missense probably damaging 1.00
R7191:Nrcam UTSW 12 44572244 missense probably benign 0.01
R7284:Nrcam UTSW 12 44564034 missense probably damaging 1.00
R7326:Nrcam UTSW 12 44564026 missense possibly damaging 0.95
R7388:Nrcam UTSW 12 44598489 missense probably damaging 1.00
R7650:Nrcam UTSW 12 44547322 missense probably damaging 1.00
R7734:Nrcam UTSW 12 44537251 missense possibly damaging 0.49
R7840:Nrcam UTSW 12 44541075 critical splice donor site probably null
R7923:Nrcam UTSW 12 44541075 critical splice donor site probably null
U24488:Nrcam UTSW 12 44537259 missense probably damaging 1.00
X0057:Nrcam UTSW 12 44551416 missense probably benign
X0066:Nrcam UTSW 12 44550029 missense probably benign 0.00
Z1176:Nrcam UTSW 12 44571570 missense probably damaging 1.00
Z1177:Nrcam UTSW 12 44574016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTACAGGGCCTGAGCATGAC -3'
(R):5'- AGATTCATGACACAGTGAGTGTGGGTA -3'

Sequencing Primer
(F):5'- AACGGTTTGTACGTTTGCCATAC -3'
(R):5'- GTGGGTATAAATGTCAACTTCTCG -3'
Posted On2013-05-29