Incidental Mutation 'R5611:Pkn3'
ID438003
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Nameprotein kinase N3
Synonyms
MMRRC Submission 043273-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30077684-30091022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30079661 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 61 (G61D)
Ref Sequence ENSEMBL: ENSMUSP00000114492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
Predicted Effect probably damaging
Transcript: ENSMUST00000045246
AA Change: G48D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: G48D

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125346
AA Change: G52D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785
AA Change: G52D

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect probably damaging
Transcript: ENSMUST00000150770
AA Change: G61D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785
AA Change: G61D

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 30081104 missense probably damaging 0.97
IGL00781:Pkn3 APN 2 30083390 unclassified probably benign
IGL00815:Pkn3 APN 2 30081200 missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 30087042 missense probably damaging 1.00
IGL01897:Pkn3 APN 2 30082812 unclassified probably benign
IGL02513:Pkn3 APN 2 30083137 missense probably damaging 0.98
IGL02552:Pkn3 APN 2 30080867 missense probably damaging 1.00
IGL02622:Pkn3 APN 2 30083146 missense probably benign 0.28
IGL02689:Pkn3 APN 2 30080846 missense probably damaging 1.00
IGL02996:Pkn3 APN 2 30080615 missense probably benign 0.39
IGL03106:Pkn3 APN 2 30085245 missense probably damaging 0.96
Enflamme UTSW 2 30083037 unclassified probably benign
Wrath UTSW 2 30088584 critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 30090527 missense probably damaging 1.00
R0279:Pkn3 UTSW 2 30083297 missense probably benign 0.16
R0370:Pkn3 UTSW 2 30087172 missense probably damaging 1.00
R0491:Pkn3 UTSW 2 30089877 missense probably damaging 1.00
R0600:Pkn3 UTSW 2 30081134 missense probably benign 0.06
R1418:Pkn3 UTSW 2 30083047 missense probably damaging 1.00
R1510:Pkn3 UTSW 2 30079764 critical splice donor site probably null
R1535:Pkn3 UTSW 2 30087053 missense probably benign
R1540:Pkn3 UTSW 2 30084691 missense probably damaging 1.00
R1808:Pkn3 UTSW 2 30079651 missense probably damaging 1.00
R1884:Pkn3 UTSW 2 30082828 missense probably damaging 1.00
R1995:Pkn3 UTSW 2 30089977 missense probably damaging 1.00
R3745:Pkn3 UTSW 2 30090341 missense probably damaging 1.00
R4119:Pkn3 UTSW 2 30083037 unclassified probably benign
R4258:Pkn3 UTSW 2 30088560 missense probably damaging 0.99
R4665:Pkn3 UTSW 2 30085457 unclassified probably benign
R4772:Pkn3 UTSW 2 30084680 splice site probably null
R4808:Pkn3 UTSW 2 30090081 missense probably damaging 1.00
R5038:Pkn3 UTSW 2 30085281 critical splice donor site probably null
R5388:Pkn3 UTSW 2 30081074 missense probably damaging 0.99
R5488:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R6001:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R6277:Pkn3 UTSW 2 30082945 missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 30080687 critical splice donor site probably null
R6724:Pkn3 UTSW 2 30090550 missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 30083536 intron probably null
R7128:Pkn3 UTSW 2 30083315 missense probably damaging 1.00
R7249:Pkn3 UTSW 2 30084761 missense probably benign 0.00
R7475:Pkn3 UTSW 2 30087110 missense probably benign 0.01
R7746:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7747:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7783:Pkn3 UTSW 2 30079622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGACACTGCAGGGTTCTG -3'
(R):5'- TCAAAGCCAAGGCCAGGATTG -3'

Sequencing Primer
(F):5'- ACTGCAGGGTTCTGAGACACTC -3'
(R):5'- CCAAGGCCAGGATTGTGTTC -3'
Posted On2016-10-26