Mutagenetix > Incidental Mutation

Incidental Mutation 'R5611:Gabbr2'

438012

Institutional Source

Beutler Lab

Gene Symbol

Gabbr2

Ensembl Gene

ENSMUSG00000039809

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 2

Synonyms

Gpr51, Gababr2, LOC242425

MMRRC Submission

043273-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R5611 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

46662305-46991873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46804105 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 250 (I250N)

Ref Sequence

ENSEMBL: ENSMUSP00000103378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107749]

AlphaFold

Q80T41

Predicted Effect

probably damaging
Transcript: ENSMUST00000107749
AA Change: I250N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: I250N

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
Pfam:Peripla_BP_6	59	434	1.5e-15	PFAM
Pfam:ANF_receptor	75	429	2e-51	PFAM
Pfam:7tm_3	492	745	6.4e-57	PFAM
PDB:4PAS\|B	778	818	1e-18	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206773

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	G	C	11: 49,020,001	T535R	possibly damaging	Het
Adam34	A	T	8: 43,651,712	F299I	probably benign	Het
Adamts20	A	G	15: 94,273,280	M1854T	possibly damaging	Het
Apbb1	A	G	7: 105,559,483	V581A	probably damaging	Het
Apol6	T	A	15: 77,051,040		probably null	Het
Arhgef37	T	C	18: 61,507,263	T242A	probably benign	Het
Asxl2	T	C	12: 3,484,598	V265A	probably damaging	Het
Bicd1	A	T	6: 149,513,456	R556*	probably null	Het
C2	A	G	17: 34,872,384	I101T	probably damaging	Het
Cd22	T	A	7: 30,878,150		probably benign	Het
Cd33	T	C	7: 43,532,118	H206R	probably damaging	Het
Cd5l	G	A	3: 87,367,775	G207D	possibly damaging	Het
Chrd	A	T	16: 20,738,974	D774V	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Csn1s1	A	T	5: 87,677,644		probably null	Het
Dpyd	G	A	3: 119,194,293	V704I	probably benign	Het
Dscc1	C	A	15: 55,082,173	Q312H	probably benign	Het
Dysf	A	T	6: 84,064,878	T154S	probably damaging	Het
Foxi2	T	C	7: 135,411,704	V221A	probably benign	Het
Gfap	T	A	11: 102,897,069	T17S	probably benign	Het
Gm9774	G	A	3: 92,428,451	P315S	probably damaging	Het
Hcrtr2	A	G	9: 76,323,314	V64A	probably damaging	Het
Igkv4-86	A	G	6: 68,910,675	S27P	probably damaging	Het
Kalrn	G	T	16: 34,175,780	F903L	probably damaging	Het
Lrrc31	A	G	3: 30,691,155		probably null	Het
Mlh3	T	C	12: 85,267,445	T656A	probably benign	Het
Mss51	G	T	14: 20,483,106	S432R	possibly damaging	Het
Mzf1	A	G	7: 13,044,627		probably benign	Het
Nop58	T	A	1: 59,710,513		probably benign	Het
Olfr121	A	T	17: 37,752,084	I77F	possibly damaging	Het
Otogl	T	C	10: 107,786,769	E1652G	probably damaging	Het
Pikfyve	C	A	1: 65,256,088	N1459K	probably damaging	Het
Pkn3	G	A	2: 30,079,661	G61D	probably damaging	Het
Plekha4	T	C	7: 45,553,641	S581P	probably benign	Het
Ppm1g	A	G	5: 31,206,097	F256L	probably damaging	Het
Proser1	A	G	3: 53,478,875	N726S	probably benign	Het
Rapgef1	A	G	2: 29,702,436	D480G	probably damaging	Het
Reln	G	A	5: 22,039,665	Q772*	probably null	Het
Sh3gl2	T	C	4: 85,355,331	V40A	probably benign	Het
Slc22a23	G	A	13: 34,305,239	T221I	probably benign	Het
Slc22a28	T	A	19: 8,063,333	T518S	probably damaging	Het
Slc4a1ap	A	G	5: 31,553,829		probably benign	Het
St8sia4	T	C	1: 95,627,684	D207G	probably damaging	Het
Syde1	T	A	10: 78,585,891	T609S	probably benign	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tle4	T	C	19: 14,449,795	D754G	probably damaging	Het
Ttn	C	T	2: 76,732,525	W26949*	probably null	Het
Vmn1r222	A	C	13: 23,232,573	S157A	probably damaging	Het
Vmn1r51	T	A	6: 90,129,710	L203M	probably benign	Het
Vmn1r6	T	C	6: 57,002,377	L8P	probably damaging	Het
Vmn2r103	A	G	17: 19,793,642	D232G	probably damaging	Het
Vmn2r17	T	A	5: 109,428,164	D300E	probably damaging	Het
Vmn2r66	T	A	7: 85,005,743	K453*	probably null	Het
Vps13a	A	T	19: 16,725,572	D672E	probably damaging	Het
Vps54	A	G	11: 21,311,130	N599S	possibly damaging	Het
Zc3h13	A	T	14: 75,330,908	N1214Y	probably benign	Het
Zc3h18	T	G	8: 122,408,370		probably null	Het
Zfp51	A	G	17: 21,464,092	E323G	probably damaging	Het

Other mutations in Gabbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Gabbr2	APN	4	46787600	missense	probably damaging	1.00
IGL00844:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL01584:Gabbr2	APN	4	46674524	missense	probably damaging	0.97
IGL01684:Gabbr2	APN	4	46736501	missense	probably benign
IGL01884:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL02073:Gabbr2	APN	4	46667547	missense	probably benign	0.00
IGL02376:Gabbr2	APN	4	46684300	missense	probably damaging	1.00
R0194:Gabbr2	UTSW	4	46787565	missense	possibly damaging	0.48
R0627:Gabbr2	UTSW	4	46681223	missense	possibly damaging	0.92
R0685:Gabbr2	UTSW	4	46787521	missense	possibly damaging	0.64
R0781:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R0882:Gabbr2	UTSW	4	46718904	missense	probably damaging	1.00
R0883:Gabbr2	UTSW	4	46677474	missense	probably benign	0.00
R1004:Gabbr2	UTSW	4	46677544	missense	possibly damaging	0.60
R1078:Gabbr2	UTSW	4	46664833	missense	probably damaging	0.99
R1110:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R1368:Gabbr2	UTSW	4	46674464	missense	probably benign	0.31
R1557:Gabbr2	UTSW	4	46846436	missense	probably damaging	1.00
R1577:Gabbr2	UTSW	4	46684319	missense	probably benign	0.29
R1645:Gabbr2	UTSW	4	46664963	splice site	probably null
R1743:Gabbr2	UTSW	4	46677603	missense	possibly damaging	0.47
R1848:Gabbr2	UTSW	4	46739823	missense	probably benign	0.31
R1997:Gabbr2	UTSW	4	46787502	missense	probably damaging	1.00
R2009:Gabbr2	UTSW	4	46734119	missense	probably damaging	1.00
R4021:Gabbr2	UTSW	4	46846435	missense	probably damaging	1.00
R4719:Gabbr2	UTSW	4	46718797	missense	probably damaging	0.99
R4757:Gabbr2	UTSW	4	46875675	missense	probably damaging	0.98
R4798:Gabbr2	UTSW	4	46991139	missense	possibly damaging	0.92
R5086:Gabbr2	UTSW	4	46724342	missense	probably damaging	1.00
R5176:Gabbr2	UTSW	4	46681208	missense	probably damaging	0.99
R5451:Gabbr2	UTSW	4	46684294	missense	probably benign	0.15
R5510:Gabbr2	UTSW	4	46734113	missense	probably damaging	1.00
R6049:Gabbr2	UTSW	4	46787641	missense	probably damaging	1.00
R6089:Gabbr2	UTSW	4	46846448	missense	probably damaging	1.00
R6118:Gabbr2	UTSW	4	46736459	missense	probably damaging	1.00
R6209:Gabbr2	UTSW	4	46804069	missense	probably damaging	1.00
R6212:Gabbr2	UTSW	4	46681189	missense	probably damaging	0.98
R6717:Gabbr2	UTSW	4	46787574	missense	possibly damaging	0.50
R7339:Gabbr2	UTSW	4	46846340	missense	probably benign	0.01
R7479:Gabbr2	UTSW	4	46681166	missense	probably damaging	0.98
R7695:Gabbr2	UTSW	4	46875687	missense	probably damaging	1.00
R7808:Gabbr2	UTSW	4	46875744	missense	possibly damaging	0.49
R7832:Gabbr2	UTSW	4	46734096	missense	probably benign	0.04
R7993:Gabbr2	UTSW	4	46736349	splice site	probably null
R7994:Gabbr2	UTSW	4	46736349	splice site	probably null
R8051:Gabbr2	UTSW	4	46736349	splice site	probably null
R8084:Gabbr2	UTSW	4	46736349	splice site	probably null
R9050:Gabbr2	UTSW	4	46798659	missense	probably benign	0.03
R9187:Gabbr2	UTSW	4	46674533	missense	probably damaging	1.00
R9622:Gabbr2	UTSW	4	46724283	critical splice donor site	probably null
R9655:Gabbr2	UTSW	4	46815684	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- ACTCAAAAGTCCCCTAGGGC -3'
(R):5'- AGAGTCACCCATCAAATCGG -3'

Sequencing Primer
(F):5'- TAGGGCTGCTGTAGTACCTCCAG -3'
(R):5'- CCATCAAATCGGGGCAGGTG -3'

Posted On

2016-10-26