Incidental Mutation 'R5611:Asxl2'
ID438040
Institutional Source Beutler Lab
Gene Symbol Asxl2
Ensembl Gene ENSMUSG00000037486
Gene Nameadditional sex combs like 2, transcriptional regulator
Synonyms
MMRRC Submission 043273-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3426857-3506852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3484598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000117384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]
Predicted Effect probably damaging
Transcript: ENSMUST00000092003
AA Change: V265A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486
AA Change: V265A

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.2e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 1.2e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111215
AA Change: V265A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486
AA Change: V265A

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 3.6e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 4.2e-52 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1305 1368 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138740
SMART Domains Protein: ENSMUSP00000133639
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 1 54 1.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144247
AA Change: V313A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486
AA Change: V313A

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 5.2e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
low complexity region 221 244 N/A INTRINSIC
Pfam:ASXH 252 384 7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153102
AA Change: V265A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486
AA Change: V265A

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 211 335 6.9e-38 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1308 1368 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219208
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Asxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Asxl2 APN 12 3474560 missense probably damaging 1.00
IGL01301:Asxl2 APN 12 3501425 missense probably damaging 1.00
IGL01325:Asxl2 APN 12 3427172 missense probably damaging 0.98
IGL01689:Asxl2 APN 12 3496425 missense probably benign 0.28
IGL01871:Asxl2 APN 12 3502112 missense probably benign 0.38
IGL02164:Asxl2 APN 12 3502079 missense probably benign 0.00
IGL02609:Asxl2 APN 12 3500018 missense probably damaging 1.00
IGL03191:Asxl2 APN 12 3500094 missense probably damaging 1.00
ANU18:Asxl2 UTSW 12 3501425 missense probably damaging 1.00
R0092:Asxl2 UTSW 12 3496313 missense probably benign 0.00
R0118:Asxl2 UTSW 12 3496923 missense probably damaging 1.00
R0277:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0323:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0584:Asxl2 UTSW 12 3496632 missense probably damaging 0.96
R0885:Asxl2 UTSW 12 3501458 missense probably damaging 1.00
R1344:Asxl2 UTSW 12 3493790 missense probably damaging 1.00
R1456:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R1829:Asxl2 UTSW 12 3457125 missense probably damaging 1.00
R1909:Asxl2 UTSW 12 3474577 missense probably damaging 1.00
R1990:Asxl2 UTSW 12 3484558 nonsense probably null
R2074:Asxl2 UTSW 12 3493779 missense probably damaging 1.00
R2883:Asxl2 UTSW 12 3501830 missense probably benign 0.03
R2912:Asxl2 UTSW 12 3474517 missense probably benign 0.06
R4446:Asxl2 UTSW 12 3501774 missense possibly damaging 0.54
R4662:Asxl2 UTSW 12 3427193 missense probably damaging 0.99
R4726:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R5034:Asxl2 UTSW 12 3502193 missense probably damaging 0.98
R5287:Asxl2 UTSW 12 3496893 missense probably benign 0.02
R5377:Asxl2 UTSW 12 3474618 splice site probably null
R5708:Asxl2 UTSW 12 3500603 missense possibly damaging 0.82
R5945:Asxl2 UTSW 12 3500439 missense possibly damaging 0.82
R6154:Asxl2 UTSW 12 3496593 missense possibly damaging 0.60
R6288:Asxl2 UTSW 12 3476040 missense possibly damaging 0.91
R6405:Asxl2 UTSW 12 3493758 missense probably damaging 0.99
R6938:Asxl2 UTSW 12 3476149 missense probably damaging 0.98
R7146:Asxl2 UTSW 12 3457066 missense probably damaging 1.00
R7354:Asxl2 UTSW 12 3455637 intron probably benign
R7396:Asxl2 UTSW 12 3442529 missense probably damaging 0.99
R7438:Asxl2 UTSW 12 3427108 start gained probably benign
R8063:Asxl2 UTSW 12 3500768 missense probably benign 0.01
R8156:Asxl2 UTSW 12 3496760 missense probably benign 0.09
Z1177:Asxl2 UTSW 12 3474589 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTTGCCTTGGACATTTCTAAGATC -3'
(R):5'- AACCATTCCCTGATCATTGGTTG -3'

Sequencing Primer
(F):5'- CTACACGGCAAACTATGATTAGATAG -3'
(R):5'- AATACTCTCTGTAGACCAGGCTGG -3'
Posted On2016-10-26