Mutagenetix > Incidental Mutation

Incidental Mutation 'R5611:Mlh3'

438041

Institutional Source

Beutler Lab

Gene Symbol

Mlh3

Ensembl Gene

ENSMUSG00000021245

Gene Name

mutL homolog 3

Synonyms

MMRRC Submission

043273-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5611 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85234520-85270599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85267445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 656 (T656A)

Ref Sequence

ENSEMBL: ENSMUSP00000152840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]

AlphaFold

A0A1Y7VMP7

Predicted Effect

probably benign
Transcript: ENSMUST00000008966

SMART Domains

Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	1	98	6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000019378
AA Change: T656A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: T656A

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117138

SMART Domains

Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

Domain	Start	End	E-Value	Type
Pfam:Acylphosphatase	1	98	6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166821
AA Change: T656A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: T656A

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220854
AA Change: T656A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000223230

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	G	C	11: 49,020,001	T535R	possibly damaging	Het
Adam34	A	T	8: 43,651,712	F299I	probably benign	Het
Adamts20	A	G	15: 94,273,280	M1854T	possibly damaging	Het
Apbb1	A	G	7: 105,559,483	V581A	probably damaging	Het
Apol6	T	A	15: 77,051,040		probably null	Het
Arhgef37	T	C	18: 61,507,263	T242A	probably benign	Het
Asxl2	T	C	12: 3,484,598	V265A	probably damaging	Het
Bicd1	A	T	6: 149,513,456	R556*	probably null	Het
C2	A	G	17: 34,872,384	I101T	probably damaging	Het
Cd22	T	A	7: 30,878,150		probably benign	Het
Cd33	T	C	7: 43,532,118	H206R	probably damaging	Het
Cd5l	G	A	3: 87,367,775	G207D	possibly damaging	Het
Chrd	A	T	16: 20,738,974	D774V	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Csn1s1	A	T	5: 87,677,644		probably null	Het
Dpyd	G	A	3: 119,194,293	V704I	probably benign	Het
Dscc1	C	A	15: 55,082,173	Q312H	probably benign	Het
Dysf	A	T	6: 84,064,878	T154S	probably damaging	Het
Foxi2	T	C	7: 135,411,704	V221A	probably benign	Het
Gabbr2	A	T	4: 46,804,105	I250N	probably damaging	Het
Gfap	T	A	11: 102,897,069	T17S	probably benign	Het
Gm9774	G	A	3: 92,428,451	P315S	probably damaging	Het
Hcrtr2	A	G	9: 76,323,314	V64A	probably damaging	Het
Igkv4-86	A	G	6: 68,910,675	S27P	probably damaging	Het
Kalrn	G	T	16: 34,175,780	F903L	probably damaging	Het
Lrrc31	A	G	3: 30,691,155		probably null	Het
Mss51	G	T	14: 20,483,106	S432R	possibly damaging	Het
Mzf1	A	G	7: 13,044,627		probably benign	Het
Nop58	T	A	1: 59,710,513		probably benign	Het
Olfr121	A	T	17: 37,752,084	I77F	possibly damaging	Het
Otogl	T	C	10: 107,786,769	E1652G	probably damaging	Het
Pikfyve	C	A	1: 65,256,088	N1459K	probably damaging	Het
Pkn3	G	A	2: 30,079,661	G61D	probably damaging	Het
Plekha4	T	C	7: 45,553,641	S581P	probably benign	Het
Ppm1g	A	G	5: 31,206,097	F256L	probably damaging	Het
Proser1	A	G	3: 53,478,875	N726S	probably benign	Het
Rapgef1	A	G	2: 29,702,436	D480G	probably damaging	Het
Reln	G	A	5: 22,039,665	Q772*	probably null	Het
Sh3gl2	T	C	4: 85,355,331	V40A	probably benign	Het
Slc22a23	G	A	13: 34,305,239	T221I	probably benign	Het
Slc22a28	T	A	19: 8,063,333	T518S	probably damaging	Het
Slc4a1ap	A	G	5: 31,553,829		probably benign	Het
St8sia4	T	C	1: 95,627,684	D207G	probably damaging	Het
Syde1	T	A	10: 78,585,891	T609S	probably benign	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tle4	T	C	19: 14,449,795	D754G	probably damaging	Het
Ttn	C	T	2: 76,732,525	W26949*	probably null	Het
Vmn1r222	A	C	13: 23,232,573	S157A	probably damaging	Het
Vmn1r51	T	A	6: 90,129,710	L203M	probably benign	Het
Vmn1r6	T	C	6: 57,002,377	L8P	probably damaging	Het
Vmn2r103	A	G	17: 19,793,642	D232G	probably damaging	Het
Vmn2r17	T	A	5: 109,428,164	D300E	probably damaging	Het
Vmn2r66	T	A	7: 85,005,743	K453*	probably null	Het
Vps13a	A	T	19: 16,725,572	D672E	probably damaging	Het
Vps54	A	G	11: 21,311,130	N599S	possibly damaging	Het
Zc3h13	A	T	14: 75,330,908	N1214Y	probably benign	Het
Zc3h18	T	G	8: 122,408,370		probably null	Het
Zfp51	A	G	17: 21,464,092	E323G	probably damaging	Het

Other mutations in Mlh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Mlh3	APN	12	85267929	missense	probably benign
IGL01462:Mlh3	APN	12	85266736	missense	probably benign
IGL01961:Mlh3	APN	12	85266344	missense	probably benign	0.00
IGL02596:Mlh3	APN	12	85240958	critical splice donor site	probably null
IGL03008:Mlh3	APN	12	85240851	missense	probably benign	0.23
IGL03142:Mlh3	APN	12	85250301	critical splice donor site	probably null
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0078:Mlh3	UTSW	12	85268818	missense	probably damaging	0.98
R0129:Mlh3	UTSW	12	85266140	splice site	probably benign
R0269:Mlh3	UTSW	12	85268405	missense	probably benign	0.00
R0393:Mlh3	UTSW	12	85267587	nonsense	probably null
R0403:Mlh3	UTSW	12	85268968	missense	possibly damaging	0.93
R0409:Mlh3	UTSW	12	85240854	missense	possibly damaging	0.95
R0587:Mlh3	UTSW	12	85266419	missense	probably benign	0.00
R0701:Mlh3	UTSW	12	85267903	missense	probably benign	0.00
R0718:Mlh3	UTSW	12	85247697	missense	possibly damaging	0.86
R0883:Mlh3	UTSW	12	85235714	missense	possibly damaging	0.89
R0989:Mlh3	UTSW	12	85269395	missense	probably benign	0.22
R0990:Mlh3	UTSW	12	85267765	missense	probably benign
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1562:Mlh3	UTSW	12	85266920	missense	probably benign	0.14
R1599:Mlh3	UTSW	12	85268369	missense	probably damaging	1.00
R1694:Mlh3	UTSW	12	85267141	missense	probably damaging	1.00
R1777:Mlh3	UTSW	12	85268754	missense	possibly damaging	0.75
R1822:Mlh3	UTSW	12	85266145	splice site	probably benign
R1874:Mlh3	UTSW	12	85237513	critical splice donor site	probably null
R1914:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R1915:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R2075:Mlh3	UTSW	12	85269141	nonsense	probably null
R2083:Mlh3	UTSW	12	85269041	missense	probably benign	0.16
R2267:Mlh3	UTSW	12	85260811	missense	possibly damaging	0.55
R2334:Mlh3	UTSW	12	85268077	missense	probably benign	0.00
R2882:Mlh3	UTSW	12	85267566	missense	probably damaging	1.00
R3623:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3624:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3963:Mlh3	UTSW	12	85268680	missense	possibly damaging	0.94
R4376:Mlh3	UTSW	12	85259198	missense	probably benign	0.00
R5334:Mlh3	UTSW	12	85245761	critical splice donor site	probably null
R5526:Mlh3	UTSW	12	85269373	nonsense	probably null
R5556:Mlh3	UTSW	12	85268493	nonsense	probably null
R5911:Mlh3	UTSW	12	85268455	missense	probably damaging	1.00
R6050:Mlh3	UTSW	12	85240846	missense	possibly damaging	0.89
R6221:Mlh3	UTSW	12	85268418	missense	possibly damaging	0.94
R6377:Mlh3	UTSW	12	85268497	missense	probably damaging	0.97
R6820:Mlh3	UTSW	12	85247723	missense	probably damaging	1.00
R6826:Mlh3	UTSW	12	85245824	missense	probably benign	0.38
R6992:Mlh3	UTSW	12	85235720	missense	probably damaging	1.00
R7217:Mlh3	UTSW	12	85266707	missense	probably benign
R7228:Mlh3	UTSW	12	85235656	missense	probably benign	0.07
R7348:Mlh3	UTSW	12	85267441	missense	probably damaging	0.99
R7599:Mlh3	UTSW	12	85268199	nonsense	probably null
R7722:Mlh3	UTSW	12	85267492	missense	probably benign	0.01
R7762:Mlh3	UTSW	12	85268284	missense	possibly damaging	0.63
R7786:Mlh3	UTSW	12	85266737	missense	probably benign	0.00
R8231:Mlh3	UTSW	12	85260798	critical splice donor site	probably null
R8415:Mlh3	UTSW	12	85269080	missense	probably benign	0.35
R8750:Mlh3	UTSW	12	85261714	missense	probably damaging	0.99
R8794:Mlh3	UTSW	12	85235723	missense	probably damaging	1.00
R9301:Mlh3	UTSW	12	85245839	missense	possibly damaging	0.77
R9385:Mlh3	UTSW	12	85269370	missense	probably damaging	1.00
R9518:Mlh3	UTSW	12	85266230	missense	probably benign	0.00
R9549:Mlh3	UTSW	12	85266475	missense	probably benign	0.01
RF014:Mlh3	UTSW	12	85268029	missense	probably benign
X0024:Mlh3	UTSW	12	85247669	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTACACCATGGGAAGGAGG -3'
(R):5'- AAAGGAGCCCAGTAGTCGTG -3'

Sequencing Primer
(F):5'- CATCAGGCAAAAGGCGATCTGTG -3'
(R):5'- CCCAGTAGTCGTGGAAGAGTAAATG -3'

Posted On

2016-10-26