Incidental Mutation 'R5613:Klf7'
ID438060
Institutional Source Beutler Lab
Gene Symbol Klf7
Ensembl Gene ENSMUSG00000025959
Gene NameKruppel-like factor 7 (ubiquitous)
Synonyms9830124P08Rik
MMRRC Submission 043274-MU
Accession Numbers

Genbank: NM_033563; MGI: 1935151

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location64029447-64122282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64042396 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 258 (R258C)
Ref Sequence ENSEMBL: ENSMUSP00000109720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055001] [ENSMUST00000114086]
Predicted Effect probably damaging
Transcript: ENSMUST00000055001
AA Change: R258C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054674
Gene: ENSMUSG00000025959
AA Change: R258C

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
ZnF_C2H2 248 272 4.94e-5 SMART
ZnF_C2H2 278 300 6.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114086
AA Change: R258C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959
AA Change: R258C

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184798
Meta Mutation Damage Score 0.7732 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice die within 3 days of life, showing lack of gastic milk, hypopnea, cyanosis, olfactory bulb hypoplasia, no response to tail clamping, impaired axon projection in the olfactory and visual systems, cerebral cortex and hippocampus, and reduced dendritic branching in the hippocampus. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Klf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Klf7 APN 1 64042317 missense possibly damaging 0.65
IGL01684:Klf7 APN 1 64120892 splice site probably benign
IGL01844:Klf7 APN 1 64078774 missense probably benign 0.02
IGL03181:Klf7 APN 1 64035726 missense possibly damaging 0.88
Esurientes UTSW 1 64079213 missense possibly damaging 0.78
C9142:Klf7 UTSW 1 64079157 missense possibly damaging 0.47
R1736:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1737:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1744:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R2048:Klf7 UTSW 1 64078754 missense possibly damaging 0.65
R2891:Klf7 UTSW 1 64042362 missense probably damaging 1.00
R5055:Klf7 UTSW 1 64079280 missense probably benign 0.08
R5782:Klf7 UTSW 1 64042411 missense possibly damaging 0.81
R7369:Klf7 UTSW 1 64121141 critical splice acceptor site probably null
R7470:Klf7 UTSW 1 64042313 critical splice donor site probably null
R8501:Klf7 UTSW 1 64079163 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGCCTGCTTGCTACTAG -3'
(R):5'- ATGGCTCAGAGGTTTGAAGG -3'

Sequencing Primer
(F):5'- GCTTGCTACTAGACCCAGATC -3'
(R):5'- ACACACAGCACCAGGGGG -3'
Posted On2016-10-26