Incidental Mutation 'R5613:Tor1aip1'
ID438062
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Nametorsin A interacting protein 1
SynonymsLAP1
MMRRC Submission 043274-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156004599-156036480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156033753 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 176 (K176E)
Ref Sequence ENSEMBL: ENSMUSP00000095134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027738] [ENSMUST00000097527] [ENSMUST00000111754] [ENSMUST00000111757] [ENSMUST00000128941] [ENSMUST00000130995] [ENSMUST00000133152] [ENSMUST00000136331] [ENSMUST00000136397] [ENSMUST00000141878] [ENSMUST00000169241]
Predicted Effect probably damaging
Transcript: ENSMUST00000027738
AA Change: K176E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027738
Gene: ENSMUSG00000026466
AA Change: K176E

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 265 9.1e-36 PFAM
Pfam:LAP1C 257 520 6.7e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097527
AA Change: K176E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095134
Gene: ENSMUSG00000026466
AA Change: K176E

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 149 167 N/A INTRINSIC
Pfam:LAP1C 244 576 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111754
Predicted Effect probably benign
Transcript: ENSMUST00000111757
SMART Domains Protein: ENSMUSP00000107387
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123705
SMART Domains Protein: ENSMUSP00000120602
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 59 4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128941
Predicted Effect possibly damaging
Transcript: ENSMUST00000130995
AA Change: K176E

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466
AA Change: K176E

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133152
Predicted Effect probably benign
Transcript: ENSMUST00000136331
AA Change: K176E

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137617
Gene: ENSMUSG00000026466
AA Change: K176E

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 283 8.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136397
SMART Domains Protein: ENSMUSP00000118654
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 5.6e-15 PFAM
Pfam:LAP1C 74 190 5.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141878
SMART Domains Protein: ENSMUSP00000123391
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 176 1.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141980
Predicted Effect probably benign
Transcript: ENSMUST00000169241
SMART Domains Protein: ENSMUSP00000126751
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 1.6e-14 PFAM
Pfam:LAP1C 75 391 2.4e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193532
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 156031467 missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 156006916 utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 156013371 missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 156035916 missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 156035844 missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 156007035 missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 156007075 missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 156007181 missense probably damaging 1.00
R0410:Tor1aip1 UTSW 1 156035940 missense possibly damaging 0.85
R0458:Tor1aip1 UTSW 1 156030407 missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 156007674 nonsense probably null
R0563:Tor1aip1 UTSW 1 156035808 missense probably damaging 1.00
R1696:Tor1aip1 UTSW 1 156017516 missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 156030434 splice site probably null
R1830:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R4487:Tor1aip1 UTSW 1 156007124 missense probably damaging 1.00
R5657:Tor1aip1 UTSW 1 156007488 missense probably damaging 1.00
R6123:Tor1aip1 UTSW 1 156007205 missense probably damaging 1.00
R6380:Tor1aip1 UTSW 1 156018488 missense possibly damaging 0.85
R6647:Tor1aip1 UTSW 1 156018253 missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 156035820 missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 156036113 missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 156007609 missense possibly damaging 0.48
R7615:Tor1aip1 UTSW 1 156007584 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGATAAGACTCACAAACCTCTTG -3'
(R):5'- TTCCCAAGTTTTGAACCTAGAGAAG -3'

Sequencing Primer
(F):5'- GGAACTCTCTTTGTAGACCAGGC -3'
(R):5'- GAAGTTGAATACTTGCATCTCTCTG -3'
Posted On2016-10-26