Incidental Mutation 'R0063:Uggt2'
ID 43807
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene Name UDP-glucose glycoprotein glucosyltransferase 2
Synonyms 3110001A05Rik, A230065J02Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2
MMRRC Submission 038355-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R0063 (G1)
Quality Score 191
Status Validated
Chromosome 14
Chromosomal Location 119222451-119336842 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 119244542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000156203]
AlphaFold E9Q4X2
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148648
Predicted Effect probably benign
Transcript: ENSMUST00000156203
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173391
SMART Domains Protein: ENSMUSP00000133772
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 2 63 9.4e-18 PFAM
SCOP:d1ga8a_ 77 216 3e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154130
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,678,912 (GRCm39) R245* probably null Het
4930563I02Rik T A 14: 60,333,477 (GRCm39) probably benign Het
Acss1 T C 2: 150,469,212 (GRCm39) T435A probably damaging Het
Aoc2 T A 11: 101,216,897 (GRCm39) S327T probably damaging Het
Arid5a T A 1: 36,357,645 (GRCm39) Y252N probably damaging Het
AU040320 T C 4: 126,733,465 (GRCm39) Y662H probably damaging Het
B4gat1 T A 19: 5,089,735 (GRCm39) L244* probably null Het
Bcam C T 7: 19,500,773 (GRCm39) V134I probably benign Het
Btbd16 A T 7: 130,424,896 (GRCm39) T426S probably benign Het
Btn1a1 C T 13: 23,649,267 (GRCm39) probably null Het
Cap2 T C 13: 46,791,508 (GRCm39) probably benign Het
Capn8 T A 1: 182,429,677 (GRCm39) D299E probably damaging Het
Cdipt G A 7: 126,578,772 (GRCm39) V160I probably benign Het
Cep164 A G 9: 45,679,916 (GRCm39) S1267P possibly damaging Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Col3a1 T C 1: 45,369,701 (GRCm39) probably benign Het
Cyb5r3 T C 15: 83,046,137 (GRCm39) T60A probably benign Het
Dgkb T G 12: 38,654,112 (GRCm39) S744A probably benign Het
Dock2 T A 11: 34,647,111 (GRCm39) probably null Het
Ece1 C T 4: 137,675,892 (GRCm39) T422M probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Elapor2 T C 5: 9,490,709 (GRCm39) probably benign Het
Eml3 C A 19: 8,915,842 (GRCm39) A644D probably damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Foxp1 A G 6: 98,921,684 (GRCm39) probably benign Het
Gm10801 G T 2: 98,494,185 (GRCm39) S109I probably benign Het
Il17rd G A 14: 26,804,690 (GRCm39) C88Y probably damaging Het
Il17rd C A 14: 26,804,691 (GRCm39) C88* probably null Het
Ino80c A G 18: 24,239,681 (GRCm39) F160S probably damaging Het
Ints8 T C 4: 11,252,857 (GRCm39) N75S probably damaging Het
Irf2bp1 C T 7: 18,739,772 (GRCm39) R471C possibly damaging Het
Irs1 T A 1: 82,266,580 (GRCm39) E545D probably damaging Het
Lama3 T C 18: 12,661,762 (GRCm39) probably benign Het
Mast4 C A 13: 103,470,723 (GRCm39) probably benign Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Nat8f2 A T 6: 85,844,815 (GRCm39) S182R possibly damaging Het
Nrcam G T 12: 44,596,811 (GRCm39) V343F possibly damaging Het
Opn5 T C 17: 42,907,517 (GRCm39) S120G probably damaging Het
Pdk2 T C 11: 94,923,306 (GRCm39) H106R probably benign Het
Pkhd1 G A 1: 20,282,174 (GRCm39) T2889I probably benign Het
Pkhd1l1 T A 15: 44,392,633 (GRCm39) L1656H probably damaging Het
Plxna2 A T 1: 194,327,247 (GRCm39) T394S probably benign Het
Pnpla8 T A 12: 44,329,615 (GRCm39) C56S probably damaging Het
Prdm8 G T 5: 98,332,453 (GRCm39) R118L probably damaging Het
Prkce T C 17: 86,789,539 (GRCm39) probably benign Het
Ptprk T A 10: 28,139,763 (GRCm39) Y163N probably damaging Het
Rbbp8 T A 18: 11,867,614 (GRCm39) probably benign Het
Rnh1 A T 7: 140,744,109 (GRCm39) probably null Het
Rtn4 T A 11: 29,655,527 (GRCm39) probably benign Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Slc2a2 T C 3: 28,771,589 (GRCm39) M173T probably damaging Het
Slc2a8 T A 2: 32,870,011 (GRCm39) probably null Het
Tdpoz1 A T 3: 93,578,121 (GRCm39) M221K probably benign Het
Tgm7 G T 2: 120,924,577 (GRCm39) H533Q probably benign Het
Timm29 C A 9: 21,504,304 (GRCm39) A17E probably benign Het
Tmem131 C T 1: 36,858,209 (GRCm39) V713I probably benign Het
Tmem89 A G 9: 108,743,880 (GRCm39) N60S probably benign Het
Tpx2 A G 2: 152,722,043 (GRCm39) T212A probably damaging Het
Trio G T 15: 27,881,523 (GRCm39) probably benign Het
Tulp2 T C 7: 45,170,284 (GRCm39) probably benign Het
Vmn2r5 T A 3: 64,411,221 (GRCm39) E449V probably benign Het
Vwa8 A G 14: 79,401,656 (GRCm39) probably benign Het
Xirp2 A G 2: 67,339,427 (GRCm39) D556G probably damaging Het
Xrn1 T C 9: 95,851,588 (GRCm39) L202P probably damaging Het
Zfp354a A T 11: 50,960,398 (GRCm39) H203L probably damaging Het
Zfp53 A C 17: 21,728,367 (GRCm39) R133S probably benign Het
Zfp787 C T 7: 6,135,322 (GRCm39) probably null Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119,286,688 (GRCm39) missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119,263,841 (GRCm39) nonsense probably null
IGL00433:Uggt2 APN 14 119,250,899 (GRCm39) missense probably benign
IGL00572:Uggt2 APN 14 119,280,203 (GRCm39) missense probably benign 0.02
IGL00577:Uggt2 APN 14 119,272,312 (GRCm39) missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119,280,211 (GRCm39) missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119,295,057 (GRCm39) missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119,280,184 (GRCm39) missense probably benign 0.00
IGL01787:Uggt2 APN 14 119,319,146 (GRCm39) missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119,326,605 (GRCm39) missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119,328,150 (GRCm39) missense probably benign 0.17
IGL02894:Uggt2 APN 14 119,319,211 (GRCm39) missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119,312,758 (GRCm39) missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119,332,722 (GRCm39) missense probably benign 0.25
IGL03142:Uggt2 APN 14 119,235,603 (GRCm39) missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119,315,080 (GRCm39) missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119,308,300 (GRCm39) missense probably benign 0.38
P0014:Uggt2 UTSW 14 119,281,950 (GRCm39) missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119,287,075 (GRCm39) missense probably benign 0.07
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0383:Uggt2 UTSW 14 119,286,863 (GRCm39) missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R0472:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119,295,010 (GRCm39) missense probably benign 0.27
R0788:Uggt2 UTSW 14 119,332,812 (GRCm39) splice site probably benign
R0940:Uggt2 UTSW 14 119,328,604 (GRCm39) critical splice donor site probably null
R1567:Uggt2 UTSW 14 119,246,505 (GRCm39) missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119,295,075 (GRCm39) missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119,292,055 (GRCm39) missense probably benign 0.19
R1746:Uggt2 UTSW 14 119,250,915 (GRCm39) missense probably benign 0.00
R1785:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119,269,688 (GRCm39) missense probably benign 0.00
R1894:Uggt2 UTSW 14 119,287,130 (GRCm39) missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119,245,467 (GRCm39) splice site probably benign
R2149:Uggt2 UTSW 14 119,312,757 (GRCm39) missense probably benign 0.02
R2168:Uggt2 UTSW 14 119,256,917 (GRCm39) missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2240:Uggt2 UTSW 14 119,232,461 (GRCm39) missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119,264,011 (GRCm39) missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119,296,521 (GRCm39) missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2907:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2908:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2998:Uggt2 UTSW 14 119,286,797 (GRCm39) missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119,328,682 (GRCm39) missense probably benign 0.39
R3722:Uggt2 UTSW 14 119,278,930 (GRCm39) missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119,295,084 (GRCm39) missense probably benign 0.13
R4015:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119,286,674 (GRCm39) missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119,256,970 (GRCm39) missense probably benign
R4642:Uggt2 UTSW 14 119,272,347 (GRCm39) missense probably benign 0.00
R4654:Uggt2 UTSW 14 119,269,670 (GRCm39) missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119,266,466 (GRCm39) splice site probably null
R4810:Uggt2 UTSW 14 119,250,933 (GRCm39) missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119,239,259 (GRCm39) missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4886:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4888:Uggt2 UTSW 14 119,315,062 (GRCm39) critical splice donor site probably null
R4888:Uggt2 UTSW 14 119,286,665 (GRCm39) missense probably damaging 1.00
R4895:Uggt2 UTSW 14 119,256,298 (GRCm39) missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119,319,182 (GRCm39) missense probably benign 0.00
R5423:Uggt2 UTSW 14 119,256,898 (GRCm39) missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119,328,121 (GRCm39) missense probably benign 0.01
R5561:Uggt2 UTSW 14 119,278,939 (GRCm39) missense probably benign 0.02
R5607:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119,315,136 (GRCm39) missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119,280,138 (GRCm39) missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119,286,838 (GRCm39) missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6056:Uggt2 UTSW 14 119,273,381 (GRCm39) critical splice donor site probably null
R6289:Uggt2 UTSW 14 119,279,014 (GRCm39) missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119,294,976 (GRCm39) missense probably benign 0.01
R6515:Uggt2 UTSW 14 119,315,131 (GRCm39) missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119,308,293 (GRCm39) missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119,280,022 (GRCm39) missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119,263,847 (GRCm39) missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119,239,271 (GRCm39) missense probably benign 0.10
R7117:Uggt2 UTSW 14 119,251,938 (GRCm39) missense probably benign 0.25
R7183:Uggt2 UTSW 14 119,257,049 (GRCm39) splice site probably null
R7337:Uggt2 UTSW 14 119,323,587 (GRCm39) missense probably benign 0.28
R7342:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119,326,681 (GRCm39) missense probably benign 0.12
R7625:Uggt2 UTSW 14 119,263,905 (GRCm39) missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119,312,759 (GRCm39) missense probably damaging 1.00
R7842:Uggt2 UTSW 14 119,235,516 (GRCm39) missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119,280,059 (GRCm39) missense probably benign 0.09
R7938:Uggt2 UTSW 14 119,296,519 (GRCm39) missense possibly damaging 0.68
R8050:Uggt2 UTSW 14 119,263,834 (GRCm39) missense probably damaging 0.98
R9007:Uggt2 UTSW 14 119,326,724 (GRCm39) missense probably damaging 1.00
R9080:Uggt2 UTSW 14 119,295,017 (GRCm39) missense probably benign 0.42
R9203:Uggt2 UTSW 14 119,294,975 (GRCm39) missense probably benign 0.08
R9215:Uggt2 UTSW 14 119,279,006 (GRCm39) missense probably damaging 1.00
R9324:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R9459:Uggt2 UTSW 14 119,286,595 (GRCm39) missense probably benign 0.02
R9647:Uggt2 UTSW 14 119,256,312 (GRCm39) missense probably damaging 1.00
R9781:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
Z1177:Uggt2 UTSW 14 119,244,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGACGGTACTTCTTGTCACAC -3'
(R):5'- CACACTCCCTTTCAGCTTGGGAAC -3'

Sequencing Primer
(F):5'- ACACTTTCCCGTCTGCG -3'
(R):5'- tttcagcttgggaacaagtTTATTAG -3'
Posted On 2013-05-29