Incidental Mutation 'R5613:Arhgef5'
ID438078
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene NameRho guanine nucleotide exchange factor (GEF) 5
Synonyms2210412D05Rik
MMRRC Submission 043274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43265582-43289320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43274063 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 583 (T583A)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
Predicted Effect probably benign
Transcript: ENSMUST00000031750
AA Change: T583A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: T583A

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 utr 5 prime probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7930:Arhgef5 UTSW 6 43275135 nonsense probably null
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCACCTTGTCACCTGTTAG -3'
(R):5'- CAGAGTCCTGTTTCAAAGCAAAC -3'

Sequencing Primer
(F):5'- TGTCACCTGTTAGCTCTTCAG -3'
(R):5'- GGAGTCTGAAAAGACGATACCATCC -3'
Posted On2016-10-26