Incidental Mutation 'R5613:Trpm1'
ID 438083
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 043274-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5613 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63858159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 333 (D333G)
Ref Sequence ENSEMBL: ENSMUSP00000146226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000206277] [ENSMUST00000206263] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206314] [ENSMUST00000206706]
AlphaFold Q2TV84
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083651
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: D333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: D333G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107515
AA Change: D200G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103139
Gene: ENSMUSG00000030523
AA Change: D200G

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 323 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107516
AA Change: T333A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141574
AA Change: D389G
Predicted Effect probably damaging
Transcript: ENSMUST00000177102
AA Change: D217G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: D217G

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000205348
AA Change: D333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: D333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: D217G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000205731
AA Change: D217G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205960
Predicted Effect probably benign
Transcript: ENSMUST00000205994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205610
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect possibly damaging
Transcript: ENSMUST00000206706
AA Change: D200G

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.9069 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,465,346 (GRCm39) probably benign Het
Adamts16 A C 13: 70,878,253 (GRCm39) S1171A probably benign Het
Agtr1b T C 3: 20,370,424 (GRCm39) T61A probably damaging Het
Ankrd35 A G 3: 96,590,334 (GRCm39) D257G possibly damaging Het
Arhgef5 A G 6: 43,250,997 (GRCm39) T583A probably benign Het
Camk2g T C 14: 20,787,559 (GRCm39) N423S probably damaging Het
Cand1 A T 10: 119,051,228 (GRCm39) H293Q possibly damaging Het
Chd4 A C 6: 125,097,509 (GRCm39) E1359D probably damaging Het
Creb3 T C 4: 43,566,196 (GRCm39) C264R probably benign Het
Cul9 T C 17: 46,814,770 (GRCm39) D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 (GRCm39) L138Q probably damaging Het
Dclk1 A G 3: 55,424,360 (GRCm39) T380A probably benign Het
Dnm2 T A 9: 21,383,963 (GRCm39) I248N probably damaging Het
Dtx4 A T 19: 12,462,767 (GRCm39) S337R probably damaging Het
Dus3l T C 17: 57,074,882 (GRCm39) S335P possibly damaging Het
Dync1h1 T C 12: 110,599,254 (GRCm39) Y1870H possibly damaging Het
Eral1 G A 11: 77,965,230 (GRCm39) probably benign Het
Eya1 G T 1: 14,373,153 (GRCm39) probably benign Het
Fbxw28 T A 9: 109,167,601 (GRCm39) Y52F probably benign Het
Fcgbpl1 A T 7: 27,842,303 (GRCm39) probably benign Het
Gm5600 A G 7: 113,307,293 (GRCm39) noncoding transcript Het
Gm5901 A G 7: 105,026,532 (GRCm39) Y100C probably damaging Het
Haus3 A G 5: 34,325,173 (GRCm39) L162P probably damaging Het
Hivep2 T C 10: 14,015,239 (GRCm39) I1802T probably damaging Het
Klf7 G A 1: 64,081,555 (GRCm39) R258C probably damaging Het
Mapt A G 11: 104,193,216 (GRCm39) N66D possibly damaging Het
Mypop G A 7: 18,725,901 (GRCm39) probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nup153 A C 13: 46,840,747 (GRCm39) S954A possibly damaging Het
Or13c7 G A 4: 43,854,528 (GRCm39) C73Y probably damaging Het
Or4a78 T C 2: 89,497,388 (GRCm39) N281D probably damaging Het
Pkn1 C T 8: 84,404,390 (GRCm39) A543T probably benign Het
Ppp1r11 C A 17: 37,262,380 (GRCm39) G7W probably damaging Het
Prss52 A T 14: 64,346,951 (GRCm39) N42Y possibly damaging Het
Ptger2 T G 14: 45,226,960 (GRCm39) V180G possibly damaging Het
Rep15 G T 6: 146,934,352 (GRCm39) V64F possibly damaging Het
Rfpl4b T A 10: 38,697,373 (GRCm39) Q76L probably benign Het
Slc11a1 G A 1: 74,420,065 (GRCm39) G191D probably damaging Het
Slc16a12 T C 19: 34,652,358 (GRCm39) M263V probably benign Het
Spdye4c A T 2: 128,434,889 (GRCm39) Q95L possibly damaging Het
Srfbp1 G A 18: 52,616,717 (GRCm39) D81N probably damaging Het
Sspo G A 6: 48,431,978 (GRCm39) V731M possibly damaging Het
Susd6 G T 12: 80,915,308 (GRCm39) G98C probably damaging Het
Tlr4 T A 4: 66,759,122 (GRCm39) S638R possibly damaging Het
Tnfsf13 G T 11: 69,574,821 (GRCm39) probably null Het
Tnfsf18 A G 1: 161,331,297 (GRCm39) N149S possibly damaging Het
Tor1aip1 T C 1: 155,909,499 (GRCm39) K176E probably damaging Het
Trav10 A T 14: 53,743,483 (GRCm39) H28L probably benign Het
Trim30a T A 7: 104,079,389 (GRCm39) K155N probably damaging Het
Tssk1 T C 16: 17,712,364 (GRCm39) S50P probably benign Het
Ttll9 CAAA CAA 2: 152,815,521 (GRCm39) probably null Het
Ttn A T 2: 76,739,996 (GRCm39) probably benign Het
Vmn2r115 A T 17: 23,564,307 (GRCm39) I160L probably benign Het
Wdr95 A T 5: 149,507,935 (GRCm39) D396V probably damaging Het
Zbtb47 T A 9: 121,596,585 (GRCm39) I647N probably damaging Het
Zfp799 T C 17: 33,038,964 (GRCm39) Y433C probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTTTGTGTGAGCAACAAGTG -3'
(R):5'- TGTCGGCAGAGAGGATTCAG -3'

Sequencing Primer
(F):5'- GAGCAACAAGTGTGGTTGTG -3'
(R):5'- TTCAGTCAGGAACAGGAGCTCC -3'
Posted On 2016-10-26