Incidental Mutation 'R5613:Camk2g'
ID438100
Institutional Source Beutler Lab
Gene Symbol Camk2g
Ensembl Gene ENSMUSG00000021820
Gene Namecalcium/calmodulin-dependent protein kinase II gamma
SynonymsCaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II
MMRRC Submission 043274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20734875-20794088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20737491 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 423 (N423S)
Ref Sequence ENSEMBL: ENSMUSP00000098398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000223679] [ENSMUST00000223863] [ENSMUST00000224887] [ENSMUST00000225328] [ENSMUST00000225609] [ENSMUST00000226630]
Predicted Effect probably benign
Transcript: ENSMUST00000071816
AA Change: N457S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820
AA Change: N457S

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
low complexity region 323 338 N/A INTRINSIC
Pfam:CaMKII_AD 397 524 2.7e-62 PFAM
Pfam:DUF4440 401 514 3.9e-12 PFAM
Pfam:SnoaL_3 401 526 4.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080440
AA Change: N446S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820
AA Change: N446S

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 386 513 3.7e-63 PFAM
Pfam:DUF4440 390 504 3.2e-14 PFAM
Pfam:SnoaL_3 390 515 4.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100837
AA Change: N423S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820
AA Change: N423S

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 363 490 3.8e-63 PFAM
Pfam:DUF4440 367 481 3.6e-14 PFAM
Pfam:SnoaL_3 367 492 4.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223679
Predicted Effect probably benign
Transcript: ENSMUST00000223712
Predicted Effect probably benign
Transcript: ENSMUST00000223863
AA Change: T63A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224887
AA Change: N235S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000225328
AA Change: N50S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000225463
Predicted Effect probably benign
Transcript: ENSMUST00000225609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225660
Predicted Effect probably benign
Transcript: ENSMUST00000226630
AA Change: N493S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dus3l T C 17: 56,767,882 S335P possibly damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Camk2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00822:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00932:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00934:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00935:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00938:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL01151:Camk2g APN 14 20765959 missense probably damaging 1.00
IGL01578:Camk2g APN 14 20747854 splice site probably benign
IGL02749:Camk2g APN 14 20766016 critical splice acceptor site probably null
changchun UTSW 14 20742708 nonsense probably null
Jilin UTSW 14 20766212 nonsense probably null
jingyuetan UTSW 14 20793931 missense possibly damaging 0.57
Manchuria UTSW 14 20764949 missense probably damaging 1.00
F5770:Camk2g UTSW 14 20739312 splice site probably benign
R0047:Camk2g UTSW 14 20771068 splice site probably benign
R0761:Camk2g UTSW 14 20766212 nonsense probably null
R0783:Camk2g UTSW 14 20744636 missense possibly damaging 0.56
R2239:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R2240:Camk2g UTSW 14 20765446 missense probably damaging 1.00
R2380:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R3623:Camk2g UTSW 14 20755707 splice site probably benign
R3842:Camk2g UTSW 14 20764898 missense probably damaging 0.99
R4909:Camk2g UTSW 14 20792584 missense probably benign 0.29
R5329:Camk2g UTSW 14 20793931 missense possibly damaging 0.57
R5763:Camk2g UTSW 14 20739347 missense probably damaging 1.00
R6294:Camk2g UTSW 14 20764949 missense probably damaging 1.00
R6345:Camk2g UTSW 14 20737375 missense probably damaging 1.00
R6698:Camk2g UTSW 14 20742708 nonsense probably null
R7010:Camk2g UTSW 14 20741444 missense probably benign
R7187:Camk2g UTSW 14 20742712 missense probably benign
R7257:Camk2g UTSW 14 20747839 missense probably benign 0.01
R7459:Camk2g UTSW 14 20779207 missense probably damaging 0.97
R7655:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
R7656:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
Z1176:Camk2g UTSW 14 20764912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGACATTGAGCCACTTG -3'
(R):5'- TGGTTGCTAGACTTGTTACCCAC -3'

Sequencing Primer
(F):5'- GGACATTGAGCCACTTGCCATC -3'
(R):5'- CCTTTTGGATGAAACTAATGCAATGG -3'
Posted On2016-10-26