Incidental Mutation 'R5613:Dus3l'
ID438111
Institutional Source Beutler Lab
Gene Symbol Dus3l
Ensembl Gene ENSMUSG00000007603
Gene Namedihydrouridine synthase 3-like (S. cerevisiae)
Synonyms
MMRRC Submission 043274-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R5613 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56764751-56770092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56767882 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 335 (S335P)
Ref Sequence ENSEMBL: ENSMUSP00000007747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007747] [ENSMUST00000168666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007747
AA Change: S335P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007747
Gene: ENSMUSG00000007603
AA Change: S335P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:ZnF_C3H1 109 136 2e-6 BLAST
Blast:ZnF_C3H1 146 172 6e-9 BLAST
Pfam:Dus 295 566 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168666
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187612
Meta Mutation Damage Score 0.4541 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,575,334 probably benign Het
9530053A07Rik A T 7: 28,142,878 probably benign Het
Adamts16 A C 13: 70,730,134 S1171A probably benign Het
Agtr1b T C 3: 20,316,260 T61A probably damaging Het
Ankrd35 A G 3: 96,683,018 D257G possibly damaging Het
Arhgef5 A G 6: 43,274,063 T583A probably benign Het
Camk2g T C 14: 20,737,491 N423S probably damaging Het
Cand1 A T 10: 119,215,323 H293Q possibly damaging Het
Chd4 A C 6: 125,120,546 E1359D probably damaging Het
Creb3 T C 4: 43,566,196 C264R probably benign Het
Cul9 T C 17: 46,503,844 D2171G probably damaging Het
Cyp7a1 A T 4: 6,272,799 L138Q probably damaging Het
Dclk1 A G 3: 55,516,939 T380A probably benign Het
Dnm2 T A 9: 21,472,667 I248N probably damaging Het
Dtx4 A T 19: 12,485,403 S337R probably damaging Het
Dync1h1 T C 12: 110,632,820 Y1870H possibly damaging Het
Eral1 G A 11: 78,074,404 probably benign Het
Eya1 G T 1: 14,302,929 probably benign Het
Fbxw28 T A 9: 109,338,533 Y52F probably benign Het
Gm5600 A G 7: 113,708,056 noncoding transcript Het
Gm5901 A G 7: 105,377,325 Y100C probably damaging Het
Haus3 A G 5: 34,167,829 L162P probably damaging Het
Hivep2 T C 10: 14,139,495 I1802T probably damaging Het
Klf7 G A 1: 64,042,396 R258C probably damaging Het
Mapt A G 11: 104,302,390 N66D possibly damaging Het
Mypop G A 7: 18,991,976 probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nup153 A C 13: 46,687,271 S954A possibly damaging Het
Olfr1251 T C 2: 89,667,044 N281D probably damaging Het
Olfr155 G A 4: 43,854,528 C73Y probably damaging Het
Pkn1 C T 8: 83,677,761 A543T probably benign Het
Ppp1r11 C A 17: 36,951,488 G7W probably damaging Het
Prss52 A T 14: 64,109,502 N42Y possibly damaging Het
Ptger2 T G 14: 44,989,503 V180G possibly damaging Het
Rep15 G T 6: 147,032,854 V64F possibly damaging Het
Rfpl4b T A 10: 38,821,377 Q76L probably benign Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc16a12 T C 19: 34,674,958 M263V probably benign Het
Spdye4c A T 2: 128,592,969 Q95L possibly damaging Het
Srfbp1 G A 18: 52,483,645 D81N probably damaging Het
Sspo G A 6: 48,455,044 V731M possibly damaging Het
Susd6 G T 12: 80,868,534 G98C probably damaging Het
Tlr4 T A 4: 66,840,885 S638R possibly damaging Het
Tnfsf13 G T 11: 69,683,995 probably null Het
Tnfsf18 A G 1: 161,503,728 N149S possibly damaging Het
Tor1aip1 T C 1: 156,033,753 K176E probably damaging Het
Trav10 A T 14: 53,506,026 H28L probably benign Het
Trim30a T A 7: 104,430,182 K155N probably damaging Het
Trpm1 A G 7: 64,208,411 D333G probably damaging Het
Tssk1 T C 16: 17,894,500 S50P probably benign Het
Ttll9 CAAA CAA 2: 152,973,601 probably null Het
Ttn A T 2: 76,909,652 probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr95 A T 5: 149,584,470 D396V probably damaging Het
Zfp651 T A 9: 121,767,519 I647N probably damaging Het
Zfp799 T C 17: 32,819,990 Y433C probably damaging Het
Other mutations in Dus3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Dus3l APN 17 56767627 unclassified probably benign
IGL02164:Dus3l APN 17 56767943 unclassified probably benign
IGL02903:Dus3l APN 17 56768363 missense probably damaging 1.00
IGL02979:Dus3l APN 17 56768140 missense possibly damaging 0.91
R0532:Dus3l UTSW 17 56769308 missense probably damaging 0.98
R1668:Dus3l UTSW 17 56766912 missense possibly damaging 0.73
R3151:Dus3l UTSW 17 56768899 missense probably benign 0.12
R4671:Dus3l UTSW 17 56768566 missense probably benign 0.02
R4737:Dus3l UTSW 17 56767868 missense probably damaging 1.00
R5198:Dus3l UTSW 17 56769574 missense probably benign 0.03
R5930:Dus3l UTSW 17 56769579 missense probably damaging 0.97
R6198:Dus3l UTSW 17 56767858 missense possibly damaging 0.46
R7206:Dus3l UTSW 17 56767807 missense probably damaging 0.98
R7316:Dus3l UTSW 17 56765551 missense possibly damaging 0.90
R8139:Dus3l UTSW 17 56767058 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGGGGCATTACTCATC -3'
(R):5'- CCACGAAGTCCACGTCAATG -3'

Sequencing Primer
(F):5'- GGCATTACTCATCCAGCGTG -3'
(R):5'- AAGTCCACGTCAATGGTGCG -3'
Posted On2016-10-26