Incidental Mutation 'R0063:Zfp53'
ID 43813
Institutional Source Beutler Lab
Gene Symbol Zfp53
Ensembl Gene ENSMUSG00000057409
Gene Name zinc finger protein 53
Synonyms Zfp118, Zfp-53, D030067O06Rik, KRAZ1, zfas8
MMRRC Submission 038355-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0063 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 21709260-21730735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21728367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 133 (R133S)
Ref Sequence ENSEMBL: ENSMUSP00000075960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076664]
AlphaFold Q9Z117
Predicted Effect probably benign
Transcript: ENSMUST00000076664
AA Change: R133S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075960
Gene: ENSMUSG00000057409
AA Change: R133S

DomainStartEndE-ValueType
KRAB 54 114 6.06e-23 SMART
ZnF_C2H2 226 248 1.18e-2 SMART
ZnF_C2H2 254 276 1.28e-3 SMART
ZnF_C2H2 282 304 2.65e-5 SMART
ZnF_C2H2 310 332 9.58e-3 SMART
ZnF_C2H2 338 360 2.86e-1 SMART
ZnF_C2H2 366 388 4.24e-4 SMART
ZnF_C2H2 394 416 4.87e-4 SMART
ZnF_C2H2 422 444 3.69e-4 SMART
ZnF_C2H2 450 472 6.23e-2 SMART
ZnF_C2H2 478 500 7.26e-3 SMART
ZnF_C2H2 506 528 1.72e-4 SMART
ZnF_C2H2 534 556 5.14e-3 SMART
ZnF_C2H2 562 584 9.08e-4 SMART
ZnF_C2H2 590 612 3.89e-3 SMART
ZnF_C2H2 618 640 4.87e-4 SMART
Meta Mutation Damage Score 0.3080 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus results in pigmentation abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,678,912 (GRCm39) R245* probably null Het
4930563I02Rik T A 14: 60,333,477 (GRCm39) probably benign Het
Acss1 T C 2: 150,469,212 (GRCm39) T435A probably damaging Het
Aoc2 T A 11: 101,216,897 (GRCm39) S327T probably damaging Het
Arid5a T A 1: 36,357,645 (GRCm39) Y252N probably damaging Het
AU040320 T C 4: 126,733,465 (GRCm39) Y662H probably damaging Het
B4gat1 T A 19: 5,089,735 (GRCm39) L244* probably null Het
Bcam C T 7: 19,500,773 (GRCm39) V134I probably benign Het
Btbd16 A T 7: 130,424,896 (GRCm39) T426S probably benign Het
Btn1a1 C T 13: 23,649,267 (GRCm39) probably null Het
Cap2 T C 13: 46,791,508 (GRCm39) probably benign Het
Capn8 T A 1: 182,429,677 (GRCm39) D299E probably damaging Het
Cdipt G A 7: 126,578,772 (GRCm39) V160I probably benign Het
Cep164 A G 9: 45,679,916 (GRCm39) S1267P possibly damaging Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Col3a1 T C 1: 45,369,701 (GRCm39) probably benign Het
Cyb5r3 T C 15: 83,046,137 (GRCm39) T60A probably benign Het
Dgkb T G 12: 38,654,112 (GRCm39) S744A probably benign Het
Dock2 T A 11: 34,647,111 (GRCm39) probably null Het
Ece1 C T 4: 137,675,892 (GRCm39) T422M probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Elapor2 T C 5: 9,490,709 (GRCm39) probably benign Het
Eml3 C A 19: 8,915,842 (GRCm39) A644D probably damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Foxp1 A G 6: 98,921,684 (GRCm39) probably benign Het
Gm10801 G T 2: 98,494,185 (GRCm39) S109I probably benign Het
Il17rd G A 14: 26,804,690 (GRCm39) C88Y probably damaging Het
Il17rd C A 14: 26,804,691 (GRCm39) C88* probably null Het
Ino80c A G 18: 24,239,681 (GRCm39) F160S probably damaging Het
Ints8 T C 4: 11,252,857 (GRCm39) N75S probably damaging Het
Irf2bp1 C T 7: 18,739,772 (GRCm39) R471C possibly damaging Het
Irs1 T A 1: 82,266,580 (GRCm39) E545D probably damaging Het
Lama3 T C 18: 12,661,762 (GRCm39) probably benign Het
Mast4 C A 13: 103,470,723 (GRCm39) probably benign Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Nat8f2 A T 6: 85,844,815 (GRCm39) S182R possibly damaging Het
Nrcam G T 12: 44,596,811 (GRCm39) V343F possibly damaging Het
Opn5 T C 17: 42,907,517 (GRCm39) S120G probably damaging Het
Pdk2 T C 11: 94,923,306 (GRCm39) H106R probably benign Het
Pkhd1 G A 1: 20,282,174 (GRCm39) T2889I probably benign Het
Pkhd1l1 T A 15: 44,392,633 (GRCm39) L1656H probably damaging Het
Plxna2 A T 1: 194,327,247 (GRCm39) T394S probably benign Het
Pnpla8 T A 12: 44,329,615 (GRCm39) C56S probably damaging Het
Prdm8 G T 5: 98,332,453 (GRCm39) R118L probably damaging Het
Prkce T C 17: 86,789,539 (GRCm39) probably benign Het
Ptprk T A 10: 28,139,763 (GRCm39) Y163N probably damaging Het
Rbbp8 T A 18: 11,867,614 (GRCm39) probably benign Het
Rnh1 A T 7: 140,744,109 (GRCm39) probably null Het
Rtn4 T A 11: 29,655,527 (GRCm39) probably benign Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Slc2a2 T C 3: 28,771,589 (GRCm39) M173T probably damaging Het
Slc2a8 T A 2: 32,870,011 (GRCm39) probably null Het
Tdpoz1 A T 3: 93,578,121 (GRCm39) M221K probably benign Het
Tgm7 G T 2: 120,924,577 (GRCm39) H533Q probably benign Het
Timm29 C A 9: 21,504,304 (GRCm39) A17E probably benign Het
Tmem131 C T 1: 36,858,209 (GRCm39) V713I probably benign Het
Tmem89 A G 9: 108,743,880 (GRCm39) N60S probably benign Het
Tpx2 A G 2: 152,722,043 (GRCm39) T212A probably damaging Het
Trio G T 15: 27,881,523 (GRCm39) probably benign Het
Tulp2 T C 7: 45,170,284 (GRCm39) probably benign Het
Uggt2 A G 14: 119,244,542 (GRCm39) probably benign Het
Vmn2r5 T A 3: 64,411,221 (GRCm39) E449V probably benign Het
Vwa8 A G 14: 79,401,656 (GRCm39) probably benign Het
Xirp2 A G 2: 67,339,427 (GRCm39) D556G probably damaging Het
Xrn1 T C 9: 95,851,588 (GRCm39) L202P probably damaging Het
Zfp354a A T 11: 50,960,398 (GRCm39) H203L probably damaging Het
Zfp787 C T 7: 6,135,322 (GRCm39) probably null Het
Other mutations in Zfp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zfp53 APN 17 21,728,600 (GRCm39) missense probably benign
IGL00862:Zfp53 APN 17 21,729,360 (GRCm39) missense probably benign 0.04
IGL01651:Zfp53 APN 17 21,728,348 (GRCm39) missense probably benign 0.19
IGL02183:Zfp53 APN 17 21,720,512 (GRCm39) missense possibly damaging 0.51
R0449:Zfp53 UTSW 17 21,729,095 (GRCm39) missense probably benign 0.17
R0514:Zfp53 UTSW 17 21,729,271 (GRCm39) missense probably damaging 1.00
R0755:Zfp53 UTSW 17 21,728,839 (GRCm39) missense probably damaging 1.00
R1661:Zfp53 UTSW 17 21,729,766 (GRCm39) missense probably damaging 1.00
R1665:Zfp53 UTSW 17 21,729,766 (GRCm39) missense probably damaging 1.00
R1693:Zfp53 UTSW 17 21,729,884 (GRCm39) missense possibly damaging 0.60
R2113:Zfp53 UTSW 17 21,728,713 (GRCm39) missense probably benign 0.19
R2869:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2869:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2870:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2870:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2871:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2871:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2873:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2874:Zfp53 UTSW 17 21,728,340 (GRCm39) missense probably benign 0.00
R2908:Zfp53 UTSW 17 21,728,736 (GRCm39) nonsense probably null
R3873:Zfp53 UTSW 17 21,728,893 (GRCm39) missense probably damaging 0.98
R4499:Zfp53 UTSW 17 21,729,497 (GRCm39) missense probably damaging 0.96
R4806:Zfp53 UTSW 17 21,725,263 (GRCm39) missense possibly damaging 0.91
R5007:Zfp53 UTSW 17 21,729,772 (GRCm39) missense probably benign 0.15
R6261:Zfp53 UTSW 17 21,728,975 (GRCm39) missense possibly damaging 0.90
R6329:Zfp53 UTSW 17 21,728,372 (GRCm39) missense probably benign 0.01
R6452:Zfp53 UTSW 17 21,729,875 (GRCm39) missense probably damaging 1.00
R6899:Zfp53 UTSW 17 21,728,707 (GRCm39) missense possibly damaging 0.62
R7033:Zfp53 UTSW 17 21,720,508 (GRCm39) missense probably benign 0.05
R7250:Zfp53 UTSW 17 21,729,840 (GRCm39) missense probably damaging 1.00
R8068:Zfp53 UTSW 17 21,729,274 (GRCm39) missense probably benign 0.06
R8491:Zfp53 UTSW 17 21,729,621 (GRCm39) missense probably benign 0.02
R9627:Zfp53 UTSW 17 21,728,745 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGGAGCCATACAGCTACAGTG -3'
(R):5'- CCTGACTTTGCAGTTTGTTTGCAGC -3'

Sequencing Primer
(F):5'- GTCAGCTACTGGGAGATCTATTC -3'
(R):5'- GCAGCATAGAGTCTCTGATTTTC -3'
Posted On 2013-05-29