Incidental Mutation 'R5614:Tollip'
ID438141
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Nametoll interacting protein
Synonyms4930403G24Rik, Toll interacting protein, 4931428G15Rik
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141874813-141918507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141892088 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 19 (T19A)
Ref Sequence ENSEMBL: ENSMUSP00000118336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
Predicted Effect probably damaging
Transcript: ENSMUST00000001950
AA Change: T88A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: T88A

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055819
AA Change: T88A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139
AA Change: T88A

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130439
AA Change: T84A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151890
AA Change: T19A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: T19A

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211231
Meta Mutation Damage Score 0.9535 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R4092:Tollip UTSW 7 141884443 missense probably damaging 1.00
R5192:Tollip UTSW 7 141892117 missense probably damaging 1.00
R6132:Tollip UTSW 7 141889597 missense probably benign 0.37
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R6830:Tollip UTSW 7 141898714 start codon destroyed probably null 0.00
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R7759:Tollip UTSW 7 141884539 missense probably benign
R8024:Tollip UTSW 7 141892826 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTACAGCACACCCATGTCTG -3'
(R):5'- GCATGTTCAAGAGCAGGTTAC -3'

Sequencing Primer
(F):5'- TGTCTGTCAGATCCCAAACTAG -3'
(R):5'- CTGACACGATTAGGTGAACTTG -3'
Posted On2016-10-26