Incidental Mutation 'R5614:Cfap54'
ID 438152
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 043275-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5614 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 92775619-93081618 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93045049 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 384 (L384P)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000020200
AA Change: L384P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014
AA Change: L384P

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 643 3e-298 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168110
AA Change: L384P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: L384P

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168617
AA Change: L336P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014
AA Change: L336P

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 148 4.3e-22 PFAM
Pfam:DUF4486 145 595 1.6e-244 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212902
AA Change: L384P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 (GRCm38) A330V probably benign Het
Abca1 A G 4: 53,046,132 (GRCm38) V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 (GRCm38) S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 (GRCm38) probably benign Het
Atp13a2 A G 4: 140,992,182 (GRCm38) T21A probably benign Het
Bud23 C A 5: 135,059,112 (GRCm38) A152S probably benign Het
Cant1 T C 11: 118,408,743 (GRCm38) D260G probably benign Het
Ces1b T C 8: 93,068,208 (GRCm38) I254M probably benign Het
Ces1d T C 8: 93,176,204 (GRCm38) T375A probably benign Het
Chrne C T 11: 70,615,053 (GRCm38) V469I possibly damaging Het
Clspn A G 4: 126,580,962 (GRCm38) E968G probably damaging Het
Col5a3 A G 9: 20,783,476 (GRCm38) probably benign Het
Dtx4 T C 19: 12,482,183 (GRCm38) Y419C probably damaging Het
Fam171b T A 2: 83,812,873 (GRCm38) I42N probably damaging Het
Fam43a T C 16: 30,601,672 (GRCm38) I358T possibly damaging Het
Fasn T C 11: 120,813,328 (GRCm38) S1422G probably benign Het
Fig4 A T 10: 41,272,985 (GRCm38) V157E probably damaging Het
Fus T C 7: 127,974,371 (GRCm38) probably benign Het
Hmcn2 G T 2: 31,428,303 (GRCm38) V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 (GRCm38) Y182C probably damaging Het
Hook2 T A 8: 85,002,508 (GRCm38) I585N probably damaging Het
Iars2 T C 1: 185,289,508 (GRCm38) T866A probably benign Het
Lrit1 T A 14: 37,061,954 (GRCm38) M413K probably benign Het
Myl9 G A 2: 156,781,163 (GRCm38) probably benign Het
Nelfa A T 5: 33,920,500 (GRCm38) L179Q probably damaging Het
Nod2 A T 8: 88,664,196 (GRCm38) D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 (GRCm38) S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 (GRCm38) F289I probably benign Het
Odf2 A G 2: 29,920,867 (GRCm38) I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 (GRCm38) V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 (GRCm38) C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 (GRCm38) T99N probably benign Het
Rnf6 T C 5: 146,218,100 (GRCm38) probably null Het
Rtp1 C A 16: 23,431,190 (GRCm38) Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 (GRCm38) V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 (GRCm38) probably benign Het
Stxbp5 A T 10: 9,760,894 (GRCm38) probably benign Het
Tecta A G 9: 42,339,055 (GRCm38) S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 (GRCm38) I394F probably benign Het
Thg1l T C 11: 45,950,227 (GRCm38) Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 (GRCm38) K572N possibly damaging Het
Tollip T C 7: 141,892,088 (GRCm38) T19A probably damaging Het
Ttn A G 2: 76,712,107 (GRCm38) Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 (GRCm38) R83* probably null Het
Wfdc8 G T 2: 164,603,203 (GRCm38) A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 (GRCm38) probably benign Het
Zfp326 T A 5: 105,888,495 (GRCm38) S91T probably damaging Het
Zfp638 T C 6: 83,929,641 (GRCm38) F263L probably damaging Het
Zfp800 G A 6: 28,243,136 (GRCm38) T610I probably damaging Het
Zmym4 A G 4: 126,910,936 (GRCm38) F475L possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93,081,523 (GRCm38) missense unknown
IGL02034:Cfap54 APN 10 93,061,485 (GRCm38) missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93,081,458 (GRCm38) missense unknown
IGL02434:Cfap54 APN 10 93,066,754 (GRCm38) missense probably benign 0.20
R0011:Cfap54 UTSW 10 93,065,225 (GRCm38) missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93,065,225 (GRCm38) missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92,932,697 (GRCm38) missense probably benign 0.04
R0032:Cfap54 UTSW 10 92,932,697 (GRCm38) missense probably benign 0.04
R0040:Cfap54 UTSW 10 92,977,039 (GRCm38) missense probably benign 0.33
R0044:Cfap54 UTSW 10 93,035,433 (GRCm38) missense probably null 0.46
R0086:Cfap54 UTSW 10 93,028,594 (GRCm38) missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93,028,652 (GRCm38) missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93,034,662 (GRCm38) unclassified probably benign
R0234:Cfap54 UTSW 10 92,899,160 (GRCm38) nonsense probably null
R0308:Cfap54 UTSW 10 92,885,364 (GRCm38) missense unknown
R0332:Cfap54 UTSW 10 93,035,457 (GRCm38) missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92,776,213 (GRCm38) missense probably benign 0.00
R0433:Cfap54 UTSW 10 92,979,080 (GRCm38) splice site probably benign
R0436:Cfap54 UTSW 10 93,038,975 (GRCm38) missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92,874,943 (GRCm38) critical splice donor site probably null
R0523:Cfap54 UTSW 10 92,908,883 (GRCm38) utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93,025,122 (GRCm38) missense probably benign 0.35
R0595:Cfap54 UTSW 10 92,884,736 (GRCm38) missense unknown
R0617:Cfap54 UTSW 10 92,829,650 (GRCm38) splice site probably benign
R0632:Cfap54 UTSW 10 92,885,096 (GRCm38) missense unknown
R0730:Cfap54 UTSW 10 93,034,737 (GRCm38) missense probably benign 0.05
R0786:Cfap54 UTSW 10 92,967,535 (GRCm38) missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92,870,669 (GRCm38) missense unknown
R1004:Cfap54 UTSW 10 93,066,696 (GRCm38) splice site probably benign
R1033:Cfap54 UTSW 10 92,839,449 (GRCm38) missense probably benign 0.07
R1168:Cfap54 UTSW 10 92,937,920 (GRCm38) missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92,875,994 (GRCm38) missense unknown
R1429:Cfap54 UTSW 10 92,821,038 (GRCm38) missense probably benign 0.01
R1443:Cfap54 UTSW 10 92,932,721 (GRCm38) missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92,969,763 (GRCm38) missense probably benign 0.01
R1557:Cfap54 UTSW 10 92,984,227 (GRCm38) missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92,932,640 (GRCm38) missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93,035,442 (GRCm38) missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93,011,020 (GRCm38) missense probably damaging 1.00
R1756:Cfap54 UTSW 10 93,048,061 (GRCm38) missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92,904,263 (GRCm38) critical splice donor site probably null
R1835:Cfap54 UTSW 10 92,962,375 (GRCm38) missense probably benign 0.35
R1889:Cfap54 UTSW 10 93,034,710 (GRCm38) missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92,884,702 (GRCm38) missense unknown
R1958:Cfap54 UTSW 10 92,997,342 (GRCm38) missense probably benign 0.18
R2005:Cfap54 UTSW 10 92,884,768 (GRCm38) missense unknown
R2018:Cfap54 UTSW 10 93,016,604 (GRCm38) missense probably benign 0.00
R2045:Cfap54 UTSW 10 93,038,809 (GRCm38) splice site probably null
R2059:Cfap54 UTSW 10 92,942,979 (GRCm38) unclassified probably benign
R2100:Cfap54 UTSW 10 93,001,937 (GRCm38) missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92,886,367 (GRCm38) missense unknown
R2392:Cfap54 UTSW 10 93,025,011 (GRCm38) critical splice donor site probably null
R2508:Cfap54 UTSW 10 92,997,374 (GRCm38) missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92,940,155 (GRCm38) missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93,045,282 (GRCm38) missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92,921,419 (GRCm38) missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92,921,419 (GRCm38) missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92,994,683 (GRCm38) missense probably benign 0.04
R3108:Cfap54 UTSW 10 92,994,683 (GRCm38) missense probably benign 0.04
R3157:Cfap54 UTSW 10 92,999,056 (GRCm38) missense probably benign 0.03
R3158:Cfap54 UTSW 10 92,999,056 (GRCm38) missense probably benign 0.03
R3159:Cfap54 UTSW 10 92,999,056 (GRCm38) missense probably benign 0.03
R3161:Cfap54 UTSW 10 93,045,278 (GRCm38) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93,045,278 (GRCm38) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93,045,278 (GRCm38) missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92,885,424 (GRCm38) missense unknown
R3730:Cfap54 UTSW 10 93,011,473 (GRCm38) nonsense probably null
R3770:Cfap54 UTSW 10 92,878,536 (GRCm38) missense unknown
R3776:Cfap54 UTSW 10 93,045,100 (GRCm38) missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92,904,344 (GRCm38) utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92,942,873 (GRCm38) unclassified probably benign
R3834:Cfap54 UTSW 10 92,801,123 (GRCm38) splice site probably benign
R3891:Cfap54 UTSW 10 93,038,846 (GRCm38) missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92,829,757 (GRCm38) missense probably benign 0.03
R3973:Cfap54 UTSW 10 92,839,471 (GRCm38) missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92,839,471 (GRCm38) missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92,839,471 (GRCm38) missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92,962,412 (GRCm38) missense probably benign 0.01
R4190:Cfap54 UTSW 10 92,885,023 (GRCm38) missense unknown
R4389:Cfap54 UTSW 10 92,967,500 (GRCm38) missense probably benign 0.37
R4542:Cfap54 UTSW 10 93,025,129 (GRCm38) missense probably benign 0.12
R4564:Cfap54 UTSW 10 92,839,540 (GRCm38) unclassified probably benign
R4576:Cfap54 UTSW 10 93,043,228 (GRCm38) critical splice donor site probably null
R4620:Cfap54 UTSW 10 92,969,757 (GRCm38) missense probably benign 0.01
R4714:Cfap54 UTSW 10 92,815,918 (GRCm38) missense probably benign 0.01
R4762:Cfap54 UTSW 10 93,061,453 (GRCm38) splice site probably null
R4776:Cfap54 UTSW 10 92,972,694 (GRCm38) missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92,836,477 (GRCm38) nonsense probably null
R4827:Cfap54 UTSW 10 92,902,075 (GRCm38) utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92,967,528 (GRCm38) missense probably benign 0.01
R4965:Cfap54 UTSW 10 93,066,799 (GRCm38) missense probably benign 0.23
R5001:Cfap54 UTSW 10 92,964,534 (GRCm38) missense probably benign 0.01
R5060:Cfap54 UTSW 10 93,039,151 (GRCm38) missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93,066,766 (GRCm38) missense probably benign 0.17
R5069:Cfap54 UTSW 10 92,937,774 (GRCm38) missense probably benign
R5094:Cfap54 UTSW 10 92,898,999 (GRCm38) utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92,937,891 (GRCm38) missense probably benign 0.03
R5127:Cfap54 UTSW 10 92,886,387 (GRCm38) splice site probably null
R5143:Cfap54 UTSW 10 93,029,158 (GRCm38) missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92,937,838 (GRCm38) missense probably benign 0.00
R5158:Cfap54 UTSW 10 93,065,197 (GRCm38) missense probably damaging 1.00
R5256:Cfap54 UTSW 10 93,045,023 (GRCm38) splice site probably null
R5256:Cfap54 UTSW 10 92,935,091 (GRCm38) nonsense probably null
R5266:Cfap54 UTSW 10 92,815,902 (GRCm38) missense probably benign 0.16
R5304:Cfap54 UTSW 10 92,821,106 (GRCm38) missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93,061,257 (GRCm38) intron probably benign
R5406:Cfap54 UTSW 10 93,001,858 (GRCm38) missense probably benign 0.33
R5471:Cfap54 UTSW 10 93,028,660 (GRCm38) missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93,029,117 (GRCm38) missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92,972,608 (GRCm38) missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92,972,611 (GRCm38) nonsense probably null
R5634:Cfap54 UTSW 10 92,904,263 (GRCm38) critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92,979,017 (GRCm38) nonsense probably null
R5797:Cfap54 UTSW 10 92,967,576 (GRCm38) missense probably benign 0.11
R5859:Cfap54 UTSW 10 93,016,524 (GRCm38) nonsense probably null
R5878:Cfap54 UTSW 10 92,964,561 (GRCm38) missense probably benign 0.01
R5910:Cfap54 UTSW 10 93,065,181 (GRCm38) missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92,962,412 (GRCm38) missense probably benign 0.01
R5994:Cfap54 UTSW 10 93,039,081 (GRCm38) missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93,045,335 (GRCm38) missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93,038,909 (GRCm38) missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93,066,846 (GRCm38) missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92,967,492 (GRCm38) missense probably benign 0.04
R6545:Cfap54 UTSW 10 92,836,457 (GRCm38) missense probably benign 0.31
R6570:Cfap54 UTSW 10 92,815,958 (GRCm38) missense unknown
R6597:Cfap54 UTSW 10 92,999,040 (GRCm38) missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92,868,734 (GRCm38) missense unknown
R6703:Cfap54 UTSW 10 92,868,734 (GRCm38) missense unknown
R6720:Cfap54 UTSW 10 92,821,119 (GRCm38) missense probably benign 0.07
R6841:Cfap54 UTSW 10 92,875,015 (GRCm38) missense unknown
R6910:Cfap54 UTSW 10 92,836,512 (GRCm38) missense probably benign 0.29
R6953:Cfap54 UTSW 10 92,994,678 (GRCm38) missense probably benign 0.19
R7009:Cfap54 UTSW 10 92,875,019 (GRCm38) missense unknown
R7129:Cfap54 UTSW 10 93,016,571 (GRCm38) missense probably benign 0.06
R7131:Cfap54 UTSW 10 92,821,104 (GRCm38) missense probably benign 0.03
R7171:Cfap54 UTSW 10 92,776,210 (GRCm38) missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92,937,728 (GRCm38) missense unknown
R7225:Cfap54 UTSW 10 92,904,374 (GRCm38) missense unknown
R7270:Cfap54 UTSW 10 92,839,458 (GRCm38) missense probably benign 0.03
R7323:Cfap54 UTSW 10 92,801,138 (GRCm38) missense probably benign 0.00
R7380:Cfap54 UTSW 10 93,047,978 (GRCm38) missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92,884,703 (GRCm38) missense unknown
R7411:Cfap54 UTSW 10 92,868,755 (GRCm38) missense unknown
R7503:Cfap54 UTSW 10 92,887,436 (GRCm38) splice site probably null
R7622:Cfap54 UTSW 10 92,956,944 (GRCm38) missense unknown
R7679:Cfap54 UTSW 10 92,967,512 (GRCm38) missense probably benign 0.01
R7776:Cfap54 UTSW 10 92,868,741 (GRCm38) missense unknown
R7844:Cfap54 UTSW 10 92,902,058 (GRCm38) missense unknown
R7980:Cfap54 UTSW 10 92,982,060 (GRCm38) missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92,902,079 (GRCm38) missense unknown
R8101:Cfap54 UTSW 10 92,884,796 (GRCm38) missense unknown
R8119:Cfap54 UTSW 10 92,868,810 (GRCm38) missense unknown
R8134:Cfap54 UTSW 10 92,878,516 (GRCm38) missense unknown
R8168:Cfap54 UTSW 10 92,908,877 (GRCm38) missense unknown
R8179:Cfap54 UTSW 10 92,997,316 (GRCm38) missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92,962,417 (GRCm38) missense unknown
R8436:Cfap54 UTSW 10 92,964,536 (GRCm38) missense unknown
R8505:Cfap54 UTSW 10 92,978,993 (GRCm38) missense probably benign 0.03
R8671:Cfap54 UTSW 10 92,955,072 (GRCm38) missense unknown
R8716:Cfap54 UTSW 10 92,964,632 (GRCm38) missense probably benign 0.00
R8816:Cfap54 UTSW 10 92,878,592 (GRCm38) missense unknown
R8822:Cfap54 UTSW 10 93,039,141 (GRCm38) missense probably benign 0.09
R8827:Cfap54 UTSW 10 92,938,248 (GRCm38) missense unknown
R8920:Cfap54 UTSW 10 92,940,337 (GRCm38) critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 93,001,823 (GRCm38) missense probably damaging 0.99
R8954:Cfap54 UTSW 10 93,043,393 (GRCm38) missense probably damaging 1.00
R8963:Cfap54 UTSW 10 93,028,700 (GRCm38) nonsense probably null
R9010:Cfap54 UTSW 10 92,899,059 (GRCm38) missense unknown
R9017:Cfap54 UTSW 10 92,816,021 (GRCm38) missense probably benign 0.07
R9093:Cfap54 UTSW 10 92,815,908 (GRCm38) missense probably benign 0.03
R9095:Cfap54 UTSW 10 93,011,020 (GRCm38) missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92,984,235 (GRCm38) missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92,994,717 (GRCm38) missense probably benign 0.10
R9196:Cfap54 UTSW 10 93,037,891 (GRCm38) missense probably benign 0.22
R9203:Cfap54 UTSW 10 93,045,128 (GRCm38) missense probably benign 0.30
R9258:Cfap54 UTSW 10 92,935,098 (GRCm38) missense unknown
R9275:Cfap54 UTSW 10 93,039,186 (GRCm38) missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92,969,703 (GRCm38) missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92,821,074 (GRCm38) missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92,962,315 (GRCm38) missense unknown
R9397:Cfap54 UTSW 10 92,997,285 (GRCm38) missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92,902,058 (GRCm38) missense unknown
R9697:Cfap54 UTSW 10 92,956,989 (GRCm38) missense unknown
R9746:Cfap54 UTSW 10 92,801,219 (GRCm38) missense probably benign 0.03
R9755:Cfap54 UTSW 10 92,921,368 (GRCm38) missense unknown
X0022:Cfap54 UTSW 10 92,932,614 (GRCm38) missense probably damaging 1.00
X0022:Cfap54 UTSW 10 92,878,603 (GRCm38) missense unknown
X0027:Cfap54 UTSW 10 93,001,888 (GRCm38) missense possibly damaging 0.86
X0027:Cfap54 UTSW 10 92,878,538 (GRCm38) missense unknown
Z1177:Cfap54 UTSW 10 92,979,026 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTCACCCATTAATGTTGC -3'
(R):5'- TGGAAGACATCTACCACGCAG -3'

Sequencing Primer
(F):5'- CACCCATTAATGTTGCAAAACTGGG -3'
(R):5'- ACGCAGCGCTATTGACTGAG -3'
Posted On 2016-10-26