Incidental Mutation 'R5615:Abca12'
ID438166
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71307059 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 884 (L884H)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect probably damaging
Transcript: ENSMUST00000087268
AA Change: L884H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: L884H

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188752
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R7946:Abca12 UTSW 1 71293497 missense probably damaging 0.96
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCTATGAAACCAACCACGAG -3'
(R):5'- GGTACATTAATAACGCCCAGTGG -3'

Sequencing Primer
(F):5'- TCGGTAGACATATCCAGGGTC -3'
(R):5'- GCCCAGTGGTGTCTGCTTC -3'
Posted On2016-10-26