Incidental Mutation 'R5615:Ugt1a10'
ID438168
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene NameUDP glycosyltransferase 1 family, polypeptide A10
SynonymsA13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5615 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location88055388-88219004 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TTCATCA to TTCA at 88216158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073049
SMART Domains Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:UDPGT 30 526 5.8e-241 PFAM
Pfam:Glyco_tran_28_C 365 454 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 88055987 missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 88056058 missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 88055863 missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 88055879 missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R0201:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 88056095 missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 88055609 missense probably benign
R1207:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88216260 missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 88055711 missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 88055981 missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 88055947 missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 88056210 missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 88055995 missense probably benign
R4474:Ugt1a10 UTSW 1 88215928 intron probably benign
R4476:Ugt1a10 UTSW 1 88215928 intron probably benign
R4515:Ugt1a10 UTSW 1 88056197 missense probably damaging 1.00
R4579:Ugt1a10 UTSW 1 88056116 missense probably benign
R4582:Ugt1a10 UTSW 1 88055741 missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 88055482 start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88218390 missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 88056287 missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88215928 intron probably benign
R4910:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 88055924 missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 88056252 splice site probably null
R5168:Ugt1a10 UTSW 1 88055809 missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R6498:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R6727:Ugt1a10 UTSW 1 88056257 splice site probably null
R6809:Ugt1a10 UTSW 1 88055925 missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 88055657 missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R7913:Ugt1a10 UTSW 1 88055755 missense probably benign 0.00
S24628:Ugt1a10 UTSW 1 88216158 small deletion probably benign
X0013:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 88055842 missense probably benign 0.20
Z1190:Ugt1a10 UTSW 1 88216158 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGACATGGAAAATCAAACCAGG -3'
(R):5'- GGCATTTTCCAAATCATCAGCAG -3'

Sequencing Primer
(F):5'- TGTGGTCCGTACACATAAGAC -3'
(R):5'- CAGTCATTTCAAGGACATTCAGGGTC -3'
Posted On2016-10-26