Incidental Mutation 'R5615:Mroh2a'
ID 438169
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Name maestro heat-like repeat family member 2A
Synonyms ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R5615 (G1)
Quality Score 207
Status Not validated
Chromosome 1
Chromosomal Location 88154713-88190011 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GCCC to GC at 88159979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
AlphaFold D3Z750
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,346,218 (GRCm39) L884H probably damaging Het
Ahr A G 12: 35,553,884 (GRCm39) V745A probably benign Het
Ankrd17 A T 5: 90,431,295 (GRCm39) S830T possibly damaging Het
Aox1 A G 1: 58,136,125 (GRCm39) T1123A probably benign Het
Arhgef11 T C 3: 87,629,792 (GRCm39) probably null Het
Bcas3 T A 11: 85,361,587 (GRCm39) C250S probably damaging Het
Bckdk T C 7: 127,506,489 (GRCm39) I272T probably damaging Het
Cacna1e T C 1: 154,287,916 (GRCm39) K1897E probably damaging Het
Cd180 A T 13: 102,842,711 (GRCm39) I586F probably benign Het
Cep290 A G 10: 100,367,012 (GRCm39) D1121G probably damaging Het
Clasrp A G 7: 19,320,372 (GRCm39) probably benign Het
Col27a1 G T 4: 63,199,351 (GRCm39) K912N probably damaging Het
Dock4 G T 12: 40,699,479 (GRCm39) R231L probably benign Het
Ell G A 8: 71,043,382 (GRCm39) S505N probably benign Het
Ephb6 A G 6: 41,596,225 (GRCm39) T833A probably benign Het
Hemk1 T A 9: 107,208,023 (GRCm39) probably null Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hspa12a T C 19: 58,793,082 (GRCm39) I368V possibly damaging Het
Igkv3-3 A T 6: 70,664,214 (GRCm39) T19S probably benign Het
Itpr1 G A 6: 108,465,561 (GRCm39) A2158T possibly damaging Het
Lancl2 T C 6: 57,699,496 (GRCm39) Y104H probably damaging Het
Leng8 G T 7: 4,147,957 (GRCm39) E634* probably null Het
Lrrk1 A T 7: 65,937,363 (GRCm39) C930S probably damaging Het
Lvrn C T 18: 46,983,395 (GRCm39) S46L possibly damaging Het
Mcidas G A 13: 113,133,959 (GRCm39) V148I probably benign Het
Mprip A T 11: 59,649,313 (GRCm39) T1006S probably benign Het
Mrgprb3 T A 7: 48,293,234 (GRCm39) M106L probably benign Het
Mtor G A 4: 148,622,733 (GRCm39) V1938I possibly damaging Het
Muc2 A G 7: 141,277,446 (GRCm39) D46G probably damaging Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Or10ag52 T A 2: 87,044,083 (GRCm39) F282L probably benign Het
Or6c215 A T 10: 129,637,636 (GRCm39) C253S probably damaging Het
Osbp2 C T 11: 3,813,356 (GRCm39) G171D probably benign Het
Otud6b A T 4: 14,818,187 (GRCm39) M238K possibly damaging Het
Pcdhac2 G A 18: 37,279,476 (GRCm39) G819R probably benign Het
Pcdhac2 G T 18: 37,279,477 (GRCm39) G819V probably benign Het
Pcdhga12 T G 18: 37,901,132 (GRCm39) S655A probably damaging Het
Pkd1l3 A G 8: 110,356,842 (GRCm39) I756V probably benign Het
Plekhd1 T A 12: 80,767,364 (GRCm39) S251T probably damaging Het
Ppp2r1a A T 17: 21,179,249 (GRCm39) T96S probably benign Het
Qser1 A C 2: 104,620,039 (GRCm39) S258A possibly damaging Het
Rsph4a G A 10: 33,785,324 (GRCm39) A412T probably benign Het
Sanbr A T 11: 23,556,759 (GRCm39) L407H probably damaging Het
Sass6 T A 3: 116,401,135 (GRCm39) C159S probably benign Het
Scaf4 T C 16: 90,048,848 (GRCm39) Q322R unknown Het
Sema6d C T 2: 124,498,821 (GRCm39) H244Y probably damaging Het
Sigirr T G 7: 140,672,632 (GRCm39) L163F probably damaging Het
Spata31d1c C A 13: 65,183,078 (GRCm39) L207I possibly damaging Het
Tacstd2 A G 6: 67,512,033 (GRCm39) F220L probably damaging Het
Tdpoz4 A T 3: 93,704,806 (GRCm39) T368S probably benign Het
Tnxb C A 17: 34,902,392 (GRCm39) Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,698,192 (GRCm39) probably benign Het
Trpm6 C T 19: 18,807,297 (GRCm39) R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r61 T A 7: 41,916,677 (GRCm39) M430K probably benign Het
Vmn2r61 A G 7: 41,949,917 (GRCm39) E779G probably damaging Het
Zfp599 T C 9: 22,165,165 (GRCm39) D70G probably benign Het
Zmym1 A T 4: 126,943,191 (GRCm39) I301N probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88,172,692 (GRCm39) missense probably benign 0.03
IGL00990:Mroh2a APN 1 88,161,842 (GRCm39) missense possibly damaging 0.76
IGL00990:Mroh2a APN 1 88,158,468 (GRCm39) missense probably damaging 0.99
IGL03097:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R0032:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0068:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0139:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0374:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R0536:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0548:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0583:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0613:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0657:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88,156,102 (GRCm39) missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0689:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0735:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0845:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0853:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0959:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R0960:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1028:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1268:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1281:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
R1414:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1439:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88,169,353 (GRCm39) missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88,160,075 (GRCm39) splice site probably benign
R1442:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R1686:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1686:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1780:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1846:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1899:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1958:Mroh2a UTSW 1 88,165,213 (GRCm39) nonsense probably null
R2122:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2248:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2306:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R2869:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2870:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2871:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3408:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3608:Mroh2a UTSW 1 88,172,717 (GRCm39) missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3937:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4022:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4133:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88,187,311 (GRCm39) missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4625:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4665:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4701:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R4701:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4771:Mroh2a UTSW 1 88,179,087 (GRCm39) missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4839:Mroh2a UTSW 1 88,165,666 (GRCm39) missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R5007:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5031:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5062:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5301:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5367:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5446:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5506:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5561:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5825:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R5891:Mroh2a UTSW 1 88,169,337 (GRCm39) missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5928:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R6004:Mroh2a UTSW 1 88,176,377 (GRCm39) missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88,158,390 (GRCm39) missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6074:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R6091:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6127:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6234:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6234:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6244:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6464:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6575:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6809:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R6819:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R8350:Mroh2a UTSW 1 88,171,805 (GRCm39) splice site probably null
R9414:Mroh2a UTSW 1 88,179,096 (GRCm39) missense probably benign 0.26
RF024:Mroh2a UTSW 1 88,170,207 (GRCm39) missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88,154,813 (GRCm39) start gained probably benign
V8831:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
X0027:Mroh2a UTSW 1 88,176,335 (GRCm39) missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0028:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0033:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,160,014 (GRCm39) missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0039:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,377 (GRCm39) missense probably benign 0.25
X0057:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0063:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1188:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Z1190:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1192:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACATATGCCCTTGAGCAG -3'
(R):5'- GCAAAGCAACCACTGGGATG -3'

Sequencing Primer
(F):5'- TATGCCCTTGAGCAGACATG -3'
(R):5'- TGGGATGCAAACCAACTTCTCATTC -3'
Posted On 2016-10-26