Incidental Mutation 'R5615:Olfr1113'
ID438172
Institutional Source Beutler Lab
Gene Symbol Olfr1113
Ensembl Gene ENSMUSG00000070857
Gene Nameolfactory receptor 1113
SynonymsMOR264-25, GA_x6K02T2Q125-48697747-48698727
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87208970-87214650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87213739 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 282 (F282L)
Ref Sequence ENSEMBL: ENSMUSP00000150991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079966] [ENSMUST00000215611]
Predicted Effect probably benign
Transcript: ENSMUST00000079966
AA Change: F282L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078883
Gene: ENSMUSG00000070857
AA Change: F282L

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 6.7e-53 PFAM
Pfam:7tm_1 56 305 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215611
AA Change: F282L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Olfr1113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Olfr1113 APN 2 87213506 missense probably damaging 0.96
IGL02523:Olfr1113 APN 2 87213320 missense probably benign 0.26
IGL03112:Olfr1113 APN 2 87213600 missense probably damaging 1.00
IGL03137:Olfr1113 APN 2 87213156 missense probably benign 0.42
R0393:Olfr1113 UTSW 2 87213693 missense probably benign
R1758:Olfr1113 UTSW 2 87213414 missense probably benign 0.13
R1920:Olfr1113 UTSW 2 87213377 missense probably benign 0.09
R1992:Olfr1113 UTSW 2 87213244 nonsense probably null
R3742:Olfr1113 UTSW 2 87212996 missense probably benign 0.00
R5665:Olfr1113 UTSW 2 87213728 missense probably benign 0.05
R5749:Olfr1113 UTSW 2 87212943 missense probably benign
R6752:Olfr1113 UTSW 2 87213044 missense probably benign
R8161:Olfr1113 UTSW 2 87213804 missense not run
Z1088:Olfr1113 UTSW 2 87213778 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGCATGTGGGAACATCTTTG -3'
(R):5'- ACCTCTTTTGACCAGTACAAAGC -3'

Sequencing Primer
(F):5'- GTGGGAACATCTTTGTGAATGAAC -3'
(R):5'- TCTTTTGACCAGTACAAAGCAAGGAG -3'
Posted On2016-10-26