Mutagenetix > Incidental Mutations

Incidental Mutation 'R5615:Arhgef11'

438175

Institutional Source

Beutler Lab

Gene Symbol

Arhgef11

Ensembl Gene

ENSMUSG00000041977

Gene Name

Rho guanine nucleotide exchange factor (GEF) 11

Synonyms

Prg, PDZ-RhoGEF

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5615 (G1)

Quality Score

122

Status

Not validated

Chromosome

Chromosomal Location

87617559-87738034 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 87722485 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]

Predicted Effect

probably null
Transcript: ENSMUST00000039476

SMART Domains

Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC
low complexity region	625	639	N/A	INTRINSIC
low complexity region	681	694	N/A	INTRINSIC
RhoGEF	768	952	1.11e-65	SMART
PH	996	1111	9.49e-6	SMART
low complexity region	1153	1166	N/A	INTRINSIC
low complexity region	1176	1188	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1357	1367	N/A	INTRINSIC
low complexity region	1478	1490	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000129113

SMART Domains

Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
RGS	313	432	3.36e-11	SMART
low complexity region	596	610	N/A	INTRINSIC
low complexity region	652	665	N/A	INTRINSIC
RhoGEF	739	923	1.11e-65	SMART
PH	967	1082	9.49e-6	SMART
low complexity region	1124	1137	N/A	INTRINSIC
low complexity region	1147	1159	N/A	INTRINSIC
low complexity region	1304	1314	N/A	INTRINSIC
low complexity region	1328	1338	N/A	INTRINSIC
low complexity region	1449	1461	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152006

SMART Domains

Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Arhgef11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Arhgef11	APN	3	87729503	missense	probably damaging	1.00
IGL00900:Arhgef11	APN	3	87683560	missense	possibly damaging	0.71
IGL01291:Arhgef11	APN	3	87733174	missense	probably benign	0.00
IGL01475:Arhgef11	APN	3	87727126	splice site	probably benign
IGL01599:Arhgef11	APN	3	87737046	missense	probably benign
IGL02251:Arhgef11	APN	3	87683547	missense	probably damaging	1.00
IGL02651:Arhgef11	APN	3	87698864	missense	probably damaging	0.99
IGL02884:Arhgef11	APN	3	87728006	missense	probably damaging	1.00
IGL02900:Arhgef11	APN	3	87733160	missense	probably benign	0.07
IGL03017:Arhgef11	APN	3	87717060	nonsense	probably null
ANU05:Arhgef11	UTSW	3	87733174	missense	probably benign	0.00
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0129:Arhgef11	UTSW	3	87728063	missense	probably damaging	1.00
R0486:Arhgef11	UTSW	3	87688852	splice site	probably null
R0698:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0701:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0849:Arhgef11	UTSW	3	87735896	missense	probably benign	0.24
R1055:Arhgef11	UTSW	3	87717118	missense	probably benign	0.19
R1256:Arhgef11	UTSW	3	87727135	missense	possibly damaging	0.81
R1401:Arhgef11	UTSW	3	87733469	nonsense	probably null
R1543:Arhgef11	UTSW	3	87713017	missense	probably benign	0.10
R1547:Arhgef11	UTSW	3	87695402	missense	possibly damaging	0.87
R1564:Arhgef11	UTSW	3	87702510	missense	probably benign
R1675:Arhgef11	UTSW	3	87731211	missense	possibly damaging	0.84
R2082:Arhgef11	UTSW	3	87725996	missense	possibly damaging	0.47
R2293:Arhgef11	UTSW	3	87727990	missense	probably damaging	1.00
R4739:Arhgef11	UTSW	3	87697999	missense	possibly damaging	0.47
R4930:Arhgef11	UTSW	3	87728594	missense	probably damaging	1.00
R5130:Arhgef11	UTSW	3	87726014	missense	possibly damaging	0.71
R5151:Arhgef11	UTSW	3	87735360	missense	probably damaging	1.00
R5157:Arhgef11	UTSW	3	87728510	splice site	probably null
R5203:Arhgef11	UTSW	3	87735357	missense	probably damaging	1.00
R5329:Arhgef11	UTSW	3	87679752	intron	probably benign
R5646:Arhgef11	UTSW	3	87684486	missense	possibly damaging	0.94
R6125:Arhgef11	UTSW	3	87729602	missense	probably damaging	1.00
R6242:Arhgef11	UTSW	3	87728078	missense	probably benign
R6543:Arhgef11	UTSW	3	87733408	missense	probably benign	0.09
R6801:Arhgef11	UTSW	3	87735852	missense	possibly damaging	0.53
R6939:Arhgef11	UTSW	3	87686920	missense	probably damaging	1.00
R7008:Arhgef11	UTSW	3	87729218	missense	possibly damaging	0.92
R7155:Arhgef11	UTSW	3	87709572	nonsense	probably null
R7169:Arhgef11	UTSW	3	87727448	missense	possibly damaging	0.79
R7325:Arhgef11	UTSW	3	87713292	missense	possibly damaging	0.62
R7392:Arhgef11	UTSW	3	87717175	critical splice donor site	probably null
R7683:Arhgef11	UTSW	3	87722383	missense	probably damaging	0.98
R7875:Arhgef11	UTSW	3	87684501	missense	probably damaging	1.00
R7912:Arhgef11	UTSW	3	87733222	missense	probably damaging	1.00
R7980:Arhgef11	UTSW	3	87697990	missense	probably benign	0.01
R8028:Arhgef11	UTSW	3	87735552	missense	probably benign
R8081:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8118:Arhgef11	UTSW	3	87735857	missense	probably damaging	1.00
R8207:Arhgef11	UTSW	3	87698775	missense	possibly damaging	0.71
R8290:Arhgef11	UTSW	3	87725968	missense	probably damaging	1.00
R8443:Arhgef11	UTSW	3	87713099	missense	probably benign	0.17
R8543:Arhgef11	UTSW	3	87681874	missense	probably damaging	1.00
X0011:Arhgef11	UTSW	3	87722406	missense	probably benign
Z1176:Arhgef11	UTSW	3	87735462	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGGAACAGAAAGCATAGTACCCTTC -3'
(R):5'- GGTCATATAATCTAACTCCATCTGAGG -3'

Sequencing Primer
(F):5'- CAGAAAGCATAGTACCCTTCATTTTC -3'
(R):5'- CTGCTCACTAGTTGGAGGATCAAC -3'

Posted On

2016-10-26