Incidental Mutation 'R5615:Zmym1'
ID438179
Institutional Source Beutler Lab
Gene Symbol Zmym1
Ensembl Gene ENSMUSG00000043872
Gene Namezinc finger, MYM domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127047094-127061152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127049398 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 301 (I301N)
Ref Sequence ENSEMBL: ENSMUSP00000101705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055013] [ENSMUST00000106099] [ENSMUST00000106102] [ENSMUST00000136186]
Predicted Effect probably damaging
Transcript: ENSMUST00000055013
AA Change: I399N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872
AA Change: I399N

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106099
AA Change: I301N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872
AA Change: I301N

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106102
AA Change: I399N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872
AA Change: I399N

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124429
Predicted Effect probably benign
Transcript: ENSMUST00000136186
SMART Domains Protein: ENSMUSP00000120772
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152607
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Other mutations in Zmym1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zmym1 APN 4 127049642 missense probably damaging 1.00
IGL02326:Zmym1 APN 4 127047760 missense probably damaging 1.00
IGL02392:Zmym1 APN 4 127048463 missense probably damaging 1.00
IGL02431:Zmym1 APN 4 127047764 nonsense probably null
IGL02512:Zmym1 APN 4 127048672 missense probably damaging 1.00
IGL03303:Zmym1 APN 4 127049134 missense probably damaging 1.00
R0195:Zmym1 UTSW 4 127047911 missense possibly damaging 0.85
R0266:Zmym1 UTSW 4 127048025 missense possibly damaging 0.86
R0416:Zmym1 UTSW 4 127058820 missense probably benign 0.00
R1374:Zmym1 UTSW 4 127049611 missense probably damaging 1.00
R1480:Zmym1 UTSW 4 127048612 missense probably damaging 0.99
R1704:Zmym1 UTSW 4 127048384 missense probably damaging 1.00
R1806:Zmym1 UTSW 4 127048079 missense probably damaging 1.00
R1815:Zmym1 UTSW 4 127049021 missense possibly damaging 0.76
R2124:Zmym1 UTSW 4 127049570 missense probably benign 0.05
R2169:Zmym1 UTSW 4 127054203 splice site probably null
R4027:Zmym1 UTSW 4 127049879 missense probably benign 0.08
R4410:Zmym1 UTSW 4 127048104 nonsense probably null
R4572:Zmym1 UTSW 4 127050835 missense probably benign 0.39
R4788:Zmym1 UTSW 4 127054297 missense probably benign 0.10
R5120:Zmym1 UTSW 4 127051437 splice site probably null
R5130:Zmym1 UTSW 4 127048658 missense probably damaging 1.00
R6190:Zmym1 UTSW 4 127047884 missense probably damaging 0.99
R7426:Zmym1 UTSW 4 127049398 missense possibly damaging 0.81
R7464:Zmym1 UTSW 4 127058935 nonsense probably null
R7540:Zmym1 UTSW 4 127048757 missense probably benign
R7779:Zmym1 UTSW 4 127054245 missense probably benign
R7807:Zmym1 UTSW 4 127047874 missense probably damaging 1.00
R7876:Zmym1 UTSW 4 127047703 missense probably damaging 0.98
R7959:Zmym1 UTSW 4 127047703 missense probably damaging 0.98
T0722:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0722:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0722:Zmym1 UTSW 4 127049673 missense probably benign 0.05
T0975:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0975:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0975:Zmym1 UTSW 4 127049673 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAATCTCCTCCTGGACAAGCG -3'
(R):5'- TTTAGCTGTCGGAGAGAAGC -3'

Sequencing Primer
(F):5'- GTGCTGCTATAGAAGTCCACG -3'
(R):5'- TTTTGCAACCCAAGGAACTGCTG -3'
Posted On2016-10-26