Mutagenetix > Incidental Mutations

Incidental Mutation 'R5615:Ephb6'

438181

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41619291 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 833 (T833A)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]

Predicted Effect

probably benign
Transcript: ENSMUST00000031902

SMART Domains

Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114732
AA Change: T833A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: T833A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194405

Predicted Effect

probably benign
Transcript: ENSMUST00000201471

SMART Domains

Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTAAGCCTTGATTCTGGGTC -3'
(R):5'- TCTTAGAGTAGAATGGCCCCG -3'

Sequencing Primer
(F):5'- CTACTCTCAGGATGGTTAAGGGAC -3'
(R):5'- TCTTAGAGTAGAATGGCCCCGAAAAG -3'

Posted On

2016-10-26