Incidental Mutation 'R5615:Tacstd2'
ID438184
Institutional Source Beutler Lab
Gene Symbol Tacstd2
Ensembl Gene ENSMUSG00000051397
Gene Nametumor-associated calcium signal transducer 2
SynonymsEGP-1, GA733-1, Ly97, TROP2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location67534062-67535796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67535049 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 220 (F220L)
Ref Sequence ENSEMBL: ENSMUSP00000060099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058178]
Predicted Effect probably damaging
Transcript: ENSMUST00000058178
AA Change: F220L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060099
Gene: ENSMUSG00000051397
AA Change: F220L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TY 99 143 1.04e-7 SMART
transmembrane domain 269 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199480
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a carcinoma-associated antigen. This antigen is a cell surface receptor that transduces calcium signals. Mutations of this gene have been associated with gelatinous drop-like corneal dystrophy.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development, life expectancy and tumorigenesis. When combined with a Cdkn2a knock-out allele, mice exhibit increased incidence of induced spindle cell carcinoma and immortalized keratinocyte proliferation and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Tacstd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Tacstd2 APN 6 67534799 missense possibly damaging 0.68
IGL02714:Tacstd2 APN 6 67535069 missense probably damaging 1.00
R0948:Tacstd2 UTSW 6 67535118 missense probably damaging 0.99
R2697:Tacstd2 UTSW 6 67535219 missense probably benign 0.01
R3735:Tacstd2 UTSW 6 67534859 missense probably damaging 1.00
R4434:Tacstd2 UTSW 6 67535144 missense possibly damaging 0.89
R4614:Tacstd2 UTSW 6 67535186 missense probably damaging 0.99
R7187:Tacstd2 UTSW 6 67535196 missense probably damaging 1.00
R7216:Tacstd2 UTSW 6 67534995 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTTCCTCCGTTTGGTGAC -3'
(R):5'- ACTCTGACCTAGACTCCGAG -3'

Sequencing Primer
(F):5'- CTACCGAGACGACAGCGATG -3'
(R):5'- ACCTAGACTCCGAGCTGCG -3'
Posted On2016-10-26