Incidental Mutation 'R5615:Leng8'
ID438188
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Nameleukocyte receptor cluster (LRC) member 8
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4137039-4148177 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 4144958 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 634 (E634*)
Ref Sequence ENSEMBL: ENSMUSP00000112428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000058358] [ENSMUST00000117274] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000132086] [ENSMUST00000144248] [ENSMUST00000154571]
Predicted Effect probably null
Transcript: ENSMUST00000037472
AA Change: E634*
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: E634*

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058358
SMART Domains Protein: ENSMUSP00000061079
Gene: ENSMUSG00000043432

DomainStartEndE-ValueType
ZnF_C3H1 8 34 1.72e-4 SMART
Pfam:DUF504 77 128 1.9e-11 PFAM
Pfam:AKAP7_NLS 305 484 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117274
SMART Domains Protein: ENSMUSP00000113223
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121270
AA Change: E634*
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545
AA Change: E634*

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably benign
Transcript: ENSMUST00000128756
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132086
SMART Domains Protein: ENSMUSP00000121129
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 29 51 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144248
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect probably benign
Transcript: ENSMUST00000154571
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4145482 missense probably benign 0.03
IGL02437:Leng8 APN 7 4142093 missense probably damaging 0.99
Coolhand UTSW 7 4144933 nonsense probably null
R0104:Leng8 UTSW 7 4143808 missense probably damaging 0.99
R0774:Leng8 UTSW 7 4142136 missense probably damaging 1.00
R1696:Leng8 UTSW 7 4145136 missense probably damaging 1.00
R2001:Leng8 UTSW 7 4145074 missense probably damaging 1.00
R2012:Leng8 UTSW 7 4143610 missense probably damaging 1.00
R2054:Leng8 UTSW 7 4144290 nonsense probably null
R3433:Leng8 UTSW 7 4142132 missense probably benign 0.22
R4335:Leng8 UTSW 7 4147038 missense probably damaging 0.99
R4607:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4608:Leng8 UTSW 7 4144797 missense probably damaging 1.00
R4886:Leng8 UTSW 7 4144931 splice site probably null
R5307:Leng8 UTSW 7 4145473 missense probably damaging 1.00
R5339:Leng8 UTSW 7 4145286 missense possibly damaging 0.96
R5368:Leng8 UTSW 7 4139988 missense probably damaging 0.97
R5370:Leng8 UTSW 7 4145434 missense possibly damaging 0.48
R5645:Leng8 UTSW 7 4145274 missense probably damaging 1.00
R5750:Leng8 UTSW 7 4142120 missense probably benign 0.04
R6041:Leng8 UTSW 7 4145569 missense probably benign 0.01
R6054:Leng8 UTSW 7 4145523 splice site probably null
R6481:Leng8 UTSW 7 4145413 missense probably damaging 1.00
R6826:Leng8 UTSW 7 4145320 missense probably damaging 1.00
R6919:Leng8 UTSW 7 4143626 missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4139526 missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4144933 nonsense probably null
R7428:Leng8 UTSW 7 4143573 missense probably damaging 1.00
R7686:Leng8 UTSW 7 4143505 nonsense probably null
R8027:Leng8 UTSW 7 4142856 frame shift probably null
R8198:Leng8 UTSW 7 4144171 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTGCATGGTCAAGTCCCAC -3'
(R):5'- ACATTGCCTGCTAAGTTTTCCG -3'

Sequencing Primer
(F):5'- CCTGTGAGCAGATGAAGTCCATTC -3'
(R):5'- TCCGCGTACAGTGACTTAAG -3'
Posted On2016-10-26