Incidental Mutation 'R5615:Vmn2r61'
ID438190
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42267253 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 430 (M430K)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably benign
Transcript: ENSMUST00000166131
AA Change: M430K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: M430K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206855
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGAACTGCCAACCCAATG -3'
(R):5'- ACTCCAGGGTTCTTCTTGGG -3'

Sequencing Primer
(F):5'- GCCAACCCAATGCTTCTTTGG -3'
(R):5'- ACTCTTATCTGGTCATGAGAACTGG -3'
Posted On2016-10-26