Incidental Mutation 'R5615:Bckdk'
ID438193
Institutional Source Beutler Lab
Gene Symbol Bckdk
Ensembl Gene ENSMUSG00000030802
Gene Namebranched chain ketoacid dehydrogenase kinase
SynonymsBCKD-kinase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5615 (G1)
Quality Score213
Status Not validated
Chromosome7
Chromosomal Location127904082-127910221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127907317 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 272 (I272T)
Ref Sequence ENSEMBL: ENSMUSP00000146115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071056] [ENSMUST00000124533] [ENSMUST00000151451] [ENSMUST00000206140] [ENSMUST00000206745]
Predicted Effect probably damaging
Transcript: ENSMUST00000071056
AA Change: I272T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070345
Gene: ENSMUSG00000030802
AA Change: I272T

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 69 222 1.8e-44 PFAM
HATPase_c 264 404 2.06e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124533
AA Change: I272T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146574
Predicted Effect probably benign
Transcript: ENSMUST00000151451
SMART Domains Protein: ENSMUSP00000116990
Gene: ENSMUSG00000030802

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 68 214 1.4e-43 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000206068
AA Change: I26T
Predicted Effect probably benign
Transcript: ENSMUST00000206140
Predicted Effect probably damaging
Transcript: ENSMUST00000206745
AA Change: I272T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Nullizygous mutations lead to altered amino acid metabolism, gait anomalies and neurobehavioral phenotypes. Homozygotes for a gene trapped allele show impaired growth, reduced fertility and epileptic seizures. Homozygotes for another gene trapped allele show motor delay and autism-like behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Bckdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Bckdk APN 7 127905776 missense possibly damaging 0.67
IGL02176:Bckdk APN 7 127906373 missense probably benign 0.31
IGL02444:Bckdk APN 7 127907446 missense probably damaging 1.00
dottie UTSW 7 127906400 nonsense probably null
Squished UTSW 7 127905418 missense probably damaging 1.00
R2105:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R2240:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2252:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2474:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3696:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3697:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3747:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3749:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3750:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3981:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4091:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4303:Bckdk UTSW 7 127905330 intron probably benign
R4367:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4369:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4371:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4841:Bckdk UTSW 7 127905461 unclassified probably null
R5930:Bckdk UTSW 7 127905973 missense probably damaging 1.00
R7215:Bckdk UTSW 7 127905110 missense possibly damaging 0.82
R7490:Bckdk UTSW 7 127904973 missense unknown
R7596:Bckdk UTSW 7 127906400 nonsense probably null
R7772:Bckdk UTSW 7 127905901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCTTAAACTAGTGGAGGGC -3'
(R):5'- ACATCTGGGACATTGTAGGGAG -3'

Sequencing Primer
(F):5'- AGAAGTGCCCTTCCATTCGAG -3'
(R):5'- AGTGTCTAGGTGACTCTCCATTG -3'
Posted On2016-10-26