Mutagenetix > Incidental Mutation

Incidental Mutation 'R5615:Muc2'

438195

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141691203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 46 (D46G)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179227] [ENSMUST00000185406]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: D46G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: D46G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- AGAAACTCTGGTTTGGAGCC -3'
(R):5'- TAATCGCACTCACATGGCC -3'

Sequencing Primer
(F):5'- CTCTGGTTTGGAGCCCCAGATG -3'
(R):5'- ACCACTGCCAGCTTGTG -3'

Posted On

2016-10-26