Incidental Mutation 'R5615:Trim41'
ID438204
Institutional Source Beutler Lab
Gene Symbol Trim41
Ensembl Gene ENSMUSG00000040365
Gene Nametripartite motif-containing 41
SynonymsRINCK
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5615 (G1)
Quality Score215
Status Not validated
Chromosome11
Chromosomal Location48806404-48817353 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCCTAGGCGCCCA to G at 48807365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020640] [ENSMUST00000047145] [ENSMUST00000131888] [ENSMUST00000140800]
Predicted Effect probably benign
Transcript: ENSMUST00000020640
SMART Domains Protein: ENSMUSP00000020640
Gene: ENSMUSG00000020372

DomainStartEndE-ValueType
WD40 4 44 5.55e-7 SMART
WD40 52 91 6.48e-8 SMART
WD40 94 133 2.95e-11 SMART
WD40 135 178 8.55e-8 SMART
WD40 181 220 2.42e-7 SMART
WD40 223 260 6.34e-2 SMART
WD40 271 311 2.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047145
SMART Domains Protein: ENSMUSP00000037055
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
RING 20 186 2.91e-6 SMART
BBOX 222 263 3.31e-10 SMART
coiled coil region 281 313 N/A INTRINSIC
coiled coil region 336 374 N/A INTRINSIC
PRY 430 482 2.04e-19 SMART
Pfam:SPRY 485 629 6.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125166
Predicted Effect probably benign
Transcript: ENSMUST00000131888
SMART Domains Protein: ENSMUSP00000119707
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
Pfam:DUF3631 9 124 9.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136849
Predicted Effect probably benign
Transcript: ENSMUST00000138019
SMART Domains Protein: ENSMUSP00000118789
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
Blast:RING 2 45 2e-6 BLAST
SCOP:d1jm7b_ 41 75 1e-4 SMART
BBOX 81 122 3.31e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139959
Predicted Effect probably benign
Transcript: ENSMUST00000140800
SMART Domains Protein: ENSMUSP00000121705
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
BBOX 19 60 3.31e-10 SMART
coiled coil region 78 110 N/A INTRINSIC
coiled coil region 133 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142269
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM family is characterized by a signature motif composed of a RING finger, one or more B-box domains, and a coiled-coil region. This encoded protein may play a role in protein kinase C signaling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Trim41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Trim41 APN 11 48812363 missense possibly damaging 0.94
IGL02959:Trim41 APN 11 48807480 missense probably damaging 1.00
R0692:Trim41 UTSW 11 48808250 unclassified probably null
R1785:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R1931:Trim41 UTSW 11 48807492 missense probably damaging 0.99
R2130:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R2132:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R2918:Trim41 UTSW 11 48816257 intron probably benign
R3018:Trim41 UTSW 11 48807694 missense probably benign 0.00
R3024:Trim41 UTSW 11 48808158 missense possibly damaging 0.48
R3770:Trim41 UTSW 11 48809084 missense possibly damaging 0.75
R5295:Trim41 UTSW 11 48816257 intron probably benign
R5616:Trim41 UTSW 11 48807365 unclassified probably benign
R6673:Trim41 UTSW 11 48816257 intron probably benign
RF010:Trim41 UTSW 11 48807338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGCCTGGGTTCAAGAG -3'
(R):5'- TGCCCGTGAATCAACCCATC -3'

Sequencing Primer
(F):5'- TGGGAGGAATCCAGGCTC -3'
(R):5'- TTAGCAGTGGGGATGCCAGC -3'
Posted On2016-10-26