Incidental Mutation 'R5615:Bcas3'
ID438206
Institutional Source Beutler Lab
Gene Symbol Bcas3
Ensembl Gene ENSMUSG00000059439
Gene Namebreast carcinoma amplified sequence 3
Synonyms2610028P08Rik, 1500019F07Rik, rudhira, K20D4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location85353167-85826058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85470761 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 250 (C250S)
Ref Sequence ENSEMBL: ENSMUSP00000103691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074875] [ENSMUST00000092821] [ENSMUST00000108056] [ENSMUST00000108061] [ENSMUST00000108062] [ENSMUST00000144276]
Predicted Effect probably damaging
Transcript: ENSMUST00000074875
AA Change: C250S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074416
Gene: ENSMUSG00000059439
AA Change: C250S

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 792 2.3e-33 PFAM
low complexity region 885 901 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092821
AA Change: C250S

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090496
Gene: ENSMUSG00000059439
AA Change: C250S

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 776 3.8e-35 PFAM
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108056
AA Change: C250S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103691
Gene: ENSMUSG00000059439
AA Change: C250S

DomainStartEndE-ValueType
Blast:WD40 56 104 7e-18 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108061
AA Change: C250S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103696
Gene: ENSMUSG00000059439
AA Change: C250S

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 789 1e-33 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108062
AA Change: C250S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103697
Gene: ENSMUSG00000059439
AA Change: C250S

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 796 1.3e-28 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144276
AA Change: C4S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114415
Gene: ENSMUSG00000059439
AA Change: C4S

DomainStartEndE-ValueType
WD40 94 134 7.7e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000154396
AA Change: C29S
SMART Domains Protein: ENSMUSP00000122154
Gene: ENSMUSG00000059439
AA Change: C29S

DomainStartEndE-ValueType
WD40 120 160 7.7e-1 SMART
WD40 170 213 2.47e1 SMART
low complexity region 260 274 N/A INTRINSIC
low complexity region 285 294 N/A INTRINSIC
Pfam:BCAS3 301 561 1e-30 PFAM
low complexity region 650 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Bcas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Bcas3 APN 11 85365591 missense probably damaging 0.98
IGL00754:Bcas3 APN 11 85495823 splice site probably benign
IGL01712:Bcas3 APN 11 85581048 missense probably damaging 0.99
IGL02073:Bcas3 APN 11 85557437 missense probably damaging 1.00
IGL02261:Bcas3 APN 11 85531930 missense probably damaging 1.00
IGL02323:Bcas3 APN 11 85495845 missense probably damaging 0.97
IGL02493:Bcas3 APN 11 85495882 missense probably damaging 0.99
IGL02609:Bcas3 APN 11 85457894 missense probably damaging 1.00
IGL02808:Bcas3 APN 11 85495851 missense probably benign 0.02
IGL03085:Bcas3 APN 11 85476783 missense probably damaging 1.00
IGL03263:Bcas3 APN 11 85822122 intron probably benign
FR4340:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4342:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4589:Bcas3 UTSW 11 85509497 missense probably benign 0.12
IGL02991:Bcas3 UTSW 11 85457887 nonsense probably null
PIT4377001:Bcas3 UTSW 11 85495842 missense probably damaging 0.98
PIT4472001:Bcas3 UTSW 11 85531900 missense probably damaging 0.99
R0145:Bcas3 UTSW 11 85359610 splice site probably benign
R0257:Bcas3 UTSW 11 85822039 missense probably benign 0.00
R0276:Bcas3 UTSW 11 85470837 critical splice donor site probably null
R0485:Bcas3 UTSW 11 85495850 missense probably damaging 0.99
R1053:Bcas3 UTSW 11 85557410 missense probably benign 0.10
R1833:Bcas3 UTSW 11 85583949 missense probably benign 0.00
R2107:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2108:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2215:Bcas3 UTSW 11 85801943 missense probably damaging 0.99
R2404:Bcas3 UTSW 11 85354889 splice site probably benign
R2413:Bcas3 UTSW 11 85531855 missense probably damaging 1.00
R3694:Bcas3 UTSW 11 85801802 missense probably benign 0.00
R3880:Bcas3 UTSW 11 85371122 missense probably benign 0.02
R4241:Bcas3 UTSW 11 85470826 missense probably damaging 0.99
R4794:Bcas3 UTSW 11 85509468 missense probably damaging 1.00
R5035:Bcas3 UTSW 11 85543945 missense probably damaging 1.00
R5073:Bcas3 UTSW 11 85371132 missense probably damaging 1.00
R5245:Bcas3 UTSW 11 85559086 missense probably damaging 1.00
R5358:Bcas3 UTSW 11 85451755 missense probably benign 0.02
R5395:Bcas3 UTSW 11 85825249 missense probably damaging 0.99
R5753:Bcas3 UTSW 11 85822084 intron probably benign
R6198:Bcas3 UTSW 11 85509435 missense probably damaging 0.99
R6668:Bcas3 UTSW 11 85801851 missense probably damaging 0.98
R7170:Bcas3 UTSW 11 85495918 missense probably damaging 0.96
R7171:Bcas3 UTSW 11 85583937 missense probably damaging 1.00
R7672:Bcas3 UTSW 11 85395387 nonsense probably null
R7689:Bcas3 UTSW 11 85495887 missense probably benign 0.10
R7912:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
R8260:Bcas3 UTSW 11 85509546 missense possibly damaging 0.50
R8292:Bcas3 UTSW 11 85457903 missense probably damaging 0.99
R8334:Bcas3 UTSW 11 85576811 missense possibly damaging 0.60
R8716:Bcas3 UTSW 11 85581042 missense probably damaging 1.00
R8812:Bcas3 UTSW 11 85559147 missense probably benign
V3553:Bcas3 UTSW 11 85822100 intron probably benign
X0020:Bcas3 UTSW 11 85531808 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGCATGAAACTGCCTTAGTGG -3'
(R):5'- TATTCGACACTTGTGAATGAGAGC -3'

Sequencing Primer
(F):5'- AAAGGGGTAAATGTGTCTCAGC -3'
(R):5'- CAGATCTCATCACAATTCAGCAGTGG -3'
Posted On2016-10-26