Mutagenetix > Incidental Mutations

Ensembl: ENSMUST00000019400

Incidental Mutation 'R5615:Ahr'

438207

Institutional Source

Beutler Lab

Gene Symbol

Ahr

Ensembl Gene

ENSMUSG00000019256

Gene Name

aryl-hydrocarbon receptor

Synonyms

bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre

Accession Numbers

Genbank: NM_013464; MGI: 105043;

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35497974-35535038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35503885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 745 (V745A)

Ref Sequence

ENSEMBL: ENSMUSP00000112137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110811

SMART Domains

Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

Domain	Start	End	E-Value	Type
HLH	33	87	3.31e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000116436
AA Change: V745A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: V745A

Domain	Start	End	E-Value	Type
HLH	33	87	5.09e-7	SMART
PAS	111	177	2.72e-12	SMART
low complexity region	212	222	N/A	INTRINSIC
PAS	266	336	1.77e-2	SMART
PAC	342	383	2.39e-8	SMART
low complexity region	606	640	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Ahr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Ahr	APN	12	35504097	nonsense	probably null
IGL01336:Ahr	APN	12	35503840	missense	probably benign	0.19
IGL01972:Ahr	APN	12	35504449	missense	possibly damaging	0.89
IGL02117:Ahr	APN	12	35512923	nonsense	probably null
IGL03028:Ahr	APN	12	35504710	missense	probably benign
IGL03110:Ahr	APN	12	35504971	missense	probably damaging	0.98
IGL03394:Ahr	APN	12	35503752	nonsense	probably null
IGL03403:Ahr	APN	12	35504326	missense	possibly damaging	0.63
BB002:Ahr	UTSW	12	35515068	nonsense	probably null
BB012:Ahr	UTSW	12	35515068	nonsense	probably null
R0620:Ahr	UTSW	12	35508194	missense	probably benign	0.26
R0784:Ahr	UTSW	12	35508142	missense	possibly damaging	0.79
R1133:Ahr	UTSW	12	35526806	missense	probably damaging	1.00
R1168:Ahr	UTSW	12	35504532	missense	possibly damaging	0.49
R4678:Ahr	UTSW	12	35507464	missense	probably damaging	1.00
R6066:Ahr	UTSW	12	35504921	missense	probably damaging	0.99
R6466:Ahr	UTSW	12	35504032	missense	probably benign	0.29
R7369:Ahr	UTSW	12	35504660	missense	possibly damaging	0.94
R7382:Ahr	UTSW	12	35504515	missense	probably damaging	1.00
R7685:Ahr	UTSW	12	35504017	missense	probably damaging	0.96
R7819:Ahr	UTSW	12	35510000	missense	probably damaging	1.00
R7897:Ahr	UTSW	12	35504170	missense	possibly damaging	0.47
R7925:Ahr	UTSW	12	35515068	nonsense	probably null
R8179:Ahr	UTSW	12	35510051	missense	probably benign	0.01
R8274:Ahr	UTSW	12	35510069	missense	probably benign
R8342:Ahr	UTSW	12	35508272	missense	probably damaging	1.00
R8985:Ahr	UTSW	12	35526737	missense	possibly damaging	0.91
R9114:Ahr	UTSW	12	35511165	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCTGTCGAAAGCCCTTAC -3'
(R):5'- CTTTTCCAGCTTACAGGGGAC -3'

Sequencing Primer
(F):5'- GTCGAAAGCCCTTACCTTGCTTAG -3'
(R):5'- GGGACTGCTCAGGAATTTCCCTAC -3'

Posted On

2016-10-26