Incidental Mutation 'R5615:Dock4'
ID438208
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40649480 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 231 (R231L)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: R231L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: R231L

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: R231L

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
R7756:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7758:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7759:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R7787:Dock4 UTSW 12 40725677 missense probably benign
R7879:Dock4 UTSW 12 40730084 missense possibly damaging 0.76
R7962:Dock4 UTSW 12 40730084 missense possibly damaging 0.76
R8000:Dock4 UTSW 12 40833119 missense probably benign 0.05
R8042:Dock4 UTSW 12 40745760 missense probably benign 0.01
RF018:Dock4 UTSW 12 40844399 frame shift probably null
RF025:Dock4 UTSW 12 40844393 frame shift probably null
RF063:Dock4 UTSW 12 40844399 frame shift probably null
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Z1176:Dock4 UTSW 12 40631614 missense probably benign 0.01
Z1176:Dock4 UTSW 12 40631616 missense probably benign 0.16
Z1177:Dock4 UTSW 12 40817641 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACTGCAAGGCATTGTCCATG -3'
(R):5'- CGAGGCCACAAAGGATTCTATAGATC -3'

Sequencing Primer
(F):5'- ATGGAACATCGACATCGG -3'
(R):5'- ATCCTCAAATCCAACGTTAATGG -3'
Posted On2016-10-26