Incidental Mutation 'R5615:Plekhd1'
ID438209
Institutional Source Beutler Lab
Gene Symbol Plekhd1
Ensembl Gene ENSMUSG00000066438
Gene Namepleckstrin homology domain containing, family D (with coiled-coil domains) member 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5615 (G1)
Quality Score206
Status Not validated
Chromosome12
Chromosomal Location80692591-80724214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80720590 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 251 (S251T)
Ref Sequence ENSEMBL: ENSMUSP00000119711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140770]
Predicted Effect probably damaging
Transcript: ENSMUST00000140770
AA Change: S251T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119711
Gene: ENSMUSG00000066438
AA Change: S251T

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
PH 29 138 9.19e-13 SMART
coiled coil region 146 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153762
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Plekhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Plekhd1 APN 12 80719007 critical splice donor site probably null
R0377:Plekhd1 UTSW 12 80706436 splice site probably benign
R0462:Plekhd1 UTSW 12 80721578 missense probably damaging 1.00
R0626:Plekhd1 UTSW 12 80717301 missense probably damaging 1.00
R1125:Plekhd1 UTSW 12 80707224 missense possibly damaging 0.83
R1344:Plekhd1 UTSW 12 80692885 missense probably benign
R1418:Plekhd1 UTSW 12 80692885 missense probably benign
R1694:Plekhd1 UTSW 12 80722321 missense possibly damaging 0.90
R2070:Plekhd1 UTSW 12 80692907 nonsense probably null
R2073:Plekhd1 UTSW 12 80721292 missense probably benign 0.19
R2231:Plekhd1 UTSW 12 80721951 missense possibly damaging 0.74
R2326:Plekhd1 UTSW 12 80722099 splice site probably null
R3615:Plekhd1 UTSW 12 80717270 missense probably damaging 1.00
R3616:Plekhd1 UTSW 12 80717270 missense probably damaging 1.00
R4899:Plekhd1 UTSW 12 80722327 missense probably damaging 1.00
R4955:Plekhd1 UTSW 12 80722021 missense possibly damaging 0.54
R5028:Plekhd1 UTSW 12 80692949 missense probably damaging 1.00
R5446:Plekhd1 UTSW 12 80720636 missense probably benign 0.00
R5648:Plekhd1 UTSW 12 80720588 missense probably damaging 1.00
R5766:Plekhd1 UTSW 12 80722366 missense probably benign
R6534:Plekhd1 UTSW 12 80707257 missense probably damaging 0.99
R7003:Plekhd1 UTSW 12 80721960 missense possibly damaging 0.92
R7615:Plekhd1 UTSW 12 80722445 missense probably benign 0.02
R7656:Plekhd1 UTSW 12 80722160 intron probably null
Predicted Primers PCR Primer
(F):5'- TGGCCGTGTTCTAAGAAAGGAG -3'
(R):5'- TAACTCGAAGGCAGACACAG -3'

Sequencing Primer
(F):5'- CCGTGTTCTAAGAAAGGAGATCTTG -3'
(R):5'- AGCCCCTCAGATGCTTAAGG -3'
Posted On2016-10-26