Mutagenetix > Incidental Mutation

Incidental Mutation 'R5615:Spata31d1c'

438210

Institutional Source

Beutler Lab

Gene Symbol

Spata31d1c

Ensembl Gene

ENSMUSG00000074849

Gene Name

spermatogenesis associated 31 subfamily D, member 1C

Synonyms

4932441B19Rik, Fam75d1c

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65033058-65038004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 65035264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 207 (L207I)

Ref Sequence

ENSEMBL: ENSMUSP00000097024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099427]

AlphaFold

E9QAF1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099427
AA Change: L207I

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: L207I

Domain	Start	End	E-Value	Type
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:DUF4599	63	148	2.4e-31	PFAM
low complexity region	178	190	N/A	INTRINSIC
low complexity region	196	213	N/A	INTRINSIC
low complexity region	218	233	N/A	INTRINSIC
low complexity region	237	251	N/A	INTRINSIC
Pfam:FAM75	380	742	1.4e-120	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Spata31d1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Spata31d1c	APN	13	65036089	missense	probably damaging	1.00
IGL02830:Spata31d1c	APN	13	65035366	missense	probably benign	0.25
IGL02947:Spata31d1c	APN	13	65034945	nonsense	probably null
IGL03133:Spata31d1c	APN	13	65034985	missense	probably benign	0.18
IGL03176:Spata31d1c	APN	13	65037011	missense	probably benign	0.01
IGL03183:Spata31d1c	APN	13	65035195	missense	possibly damaging	0.86
IGL03206:Spata31d1c	APN	13	65035593	missense	probably benign	0.41
PIT4382001:Spata31d1c	UTSW	13	65036171	missense	probably benign	0.01
R0054:Spata31d1c	UTSW	13	65033062	start gained	probably benign
R0959:Spata31d1c	UTSW	13	65036315	missense	probably damaging	1.00
R1232:Spata31d1c	UTSW	13	65036614	missense	probably benign
R1347:Spata31d1c	UTSW	13	65035388	missense	probably benign	0.00
R1381:Spata31d1c	UTSW	13	65036554	missense	probably benign	0.08
R1573:Spata31d1c	UTSW	13	65035069	missense	possibly damaging	0.92
R1582:Spata31d1c	UTSW	13	65033224	missense	probably benign
R1639:Spata31d1c	UTSW	13	65036039	missense	probably benign
R1716:Spata31d1c	UTSW	13	65033216	missense	possibly damaging	0.86
R1781:Spata31d1c	UTSW	13	65036171	missense	probably benign	0.01
R1907:Spata31d1c	UTSW	13	65035876	missense	probably benign	0.03
R2012:Spata31d1c	UTSW	13	65035227	missense	possibly damaging	0.91
R2152:Spata31d1c	UTSW	13	65033965	critical splice donor site	probably null
R2211:Spata31d1c	UTSW	13	65035939	missense	probably benign	0.04
R2571:Spata31d1c	UTSW	13	65036384	missense	probably damaging	1.00
R2908:Spata31d1c	UTSW	13	65033191	missense	possibly damaging	0.63
R3978:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3979:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3980:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3981:Spata31d1c	UTSW	13	65035111	missense	possibly damaging	0.68
R4014:Spata31d1c	UTSW	13	65035399	missense	probably damaging	0.99
R4255:Spata31d1c	UTSW	13	65035688	nonsense	probably null
R4255:Spata31d1c	UTSW	13	65035717	missense	probably benign	0.04
R4592:Spata31d1c	UTSW	13	65036060	missense	probably damaging	0.99
R4597:Spata31d1c	UTSW	13	65035613	nonsense	probably null
R4624:Spata31d1c	UTSW	13	65036597	missense	probably benign
R4641:Spata31d1c	UTSW	13	65035048	missense	probably benign	0.01
R4863:Spata31d1c	UTSW	13	65035790	nonsense	probably null
R5084:Spata31d1c	UTSW	13	65035130	missense	probably damaging	0.98
R5152:Spata31d1c	UTSW	13	65035595	missense	probably damaging	1.00
R5230:Spata31d1c	UTSW	13	65035434	missense	probably benign	0.41
R5267:Spata31d1c	UTSW	13	65035904	missense	probably damaging	0.98
R5755:Spata31d1c	UTSW	13	65036527	missense	probably benign	0.12
R5935:Spata31d1c	UTSW	13	65037080	missense	possibly damaging	0.68
R6017:Spata31d1c	UTSW	13	65035079	missense	possibly damaging	0.91
R6131:Spata31d1c	UTSW	13	65035671	missense	probably benign	0.10
R6359:Spata31d1c	UTSW	13	65035592	missense	possibly damaging	0.63
R6723:Spata31d1c	UTSW	13	65035944	missense	probably benign	0.01
R7028:Spata31d1c	UTSW	13	65036063	missense	probably damaging	0.98
R7336:Spata31d1c	UTSW	13	65036128	missense	probably damaging	0.99
R7426:Spata31d1c	UTSW	13	65035361	missense	probably benign
R7552:Spata31d1c	UTSW	13	65036123	missense	probably damaging	0.98
R7605:Spata31d1c	UTSW	13	65035840	missense	probably benign	0.00
R7666:Spata31d1c	UTSW	13	65036000	missense	probably benign	0.01
R8403:Spata31d1c	UTSW	13	65036230	missense	probably benign	0.42
R8445:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8513:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8515:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8523:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8799:Spata31d1c	UTSW	13	65036326	missense	possibly damaging	0.92
R8817:Spata31d1c	UTSW	13	65034562	missense	probably damaging	0.98
R8854:Spata31d1c	UTSW	13	65035990	missense	possibly damaging	0.82
R8917:Spata31d1c	UTSW	13	65035615	missense	probably benign	0.02
R9084:Spata31d1c	UTSW	13	65035145	missense	probably benign
R9197:Spata31d1c	UTSW	13	65035876	missense	probably benign	0.01
R9201:Spata31d1c	UTSW	13	65036959	missense	possibly damaging	0.48
R9261:Spata31d1c	UTSW	13	65036866	missense	probably damaging	0.99
R9516:Spata31d1c	UTSW	13	65036226	missense	probably damaging	1.00
X0022:Spata31d1c	UTSW	13	65036927	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CCAGTCTGGACTCCACAGTTTC -3'
(R):5'- GCATGACTTGAACTGCAAATGC -3'

Sequencing Primer
(F):5'- CAGTTTCTGTGACGGAGACAGC -3'
(R):5'- GACTTGAACTGCAAATGCCATTG -3'

Posted On

2016-10-26