Incidental Mutation 'R5615:Mcidas'
ID438212
Institutional Source Beutler Lab
Gene Symbol Mcidas
Ensembl Gene ENSMUSG00000074651
Gene Namemulticiliate differentiation and DNA synthesis associated cell cycle protein
SynonymsIdas, Mci, multicilin, Mcin, Gm6320
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112993845-113000394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112997425 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 148 (V148I)
Ref Sequence ENSEMBL: ENSMUSP00000089721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092089]
Predicted Effect probably benign
Transcript: ENSMUST00000092089
AA Change: V148I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089721
Gene: ENSMUSG00000074651
AA Change: V148I

DomainStartEndE-ValueType
low complexity region 60 73 N/A INTRINSIC
Pfam:Geminin 169 258 4.8e-20 PFAM
low complexity region 262 272 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the geminin family of proteins. The encoded nuclear protein is required for the generation of multiciliated cells in respiratory epithelium. Mutations in this gene cause a rare mucociliary clearance disorder associated with recurring respiratory infections in human patients, known as reduced generation of multiple motile cilia (RGMC). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Mcidas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mcidas APN 13 112997585 splice site probably benign
IGL01355:Mcidas APN 13 112999069 missense probably damaging 1.00
IGL02000:Mcidas APN 13 112997440 missense probably benign
IGL02019:Mcidas APN 13 112996843 missense probably benign 0.00
R0145:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R0412:Mcidas UTSW 13 112999143 missense probably damaging 1.00
R1293:Mcidas UTSW 13 112997392 missense probably benign
R2011:Mcidas UTSW 13 112993981 missense possibly damaging 0.84
R4183:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R4905:Mcidas UTSW 13 112994417 missense possibly damaging 0.84
R4905:Mcidas UTSW 13 112997504 missense possibly damaging 0.82
R5997:Mcidas UTSW 13 112998586 missense probably damaging 0.99
R6848:Mcidas UTSW 13 112993885 missense probably benign
R7387:Mcidas UTSW 13 112994088 missense probably benign 0.03
R7398:Mcidas UTSW 13 112996882 missense probably benign
R7742:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7795:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7797:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7872:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7873:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7955:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7956:Mcidas UTSW 13 112998987 missense probably damaging 1.00
X0066:Mcidas UTSW 13 112997447 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGGTTAGCTCAGCAGGTG -3'
(R):5'- GCTCTATTCCAAAATTCCCAGC -3'

Sequencing Primer
(F):5'- TTAGCTCAGCAGGTGTATAGAGC -3'
(R):5'- CCAGCAGCATCCCTACTTGG -3'
Posted On2016-10-26