Incidental Mutation 'R5615:Ppp2r1a'
ID438215
Institutional Source Beutler Lab
Gene Symbol Ppp2r1a
Ensembl Gene ENSMUSG00000007564
Gene Nameprotein phosphatase 2, regulatory subunit A, alpha
SynonymsPR65, PP2A, 6330556D22Rik, protein phosphatase PP2A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20945311-20965916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20958987 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 96 (T96S)
Ref Sequence ENSEMBL: ENSMUSP00000133334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007708] [ENSMUST00000147983] [ENSMUST00000173658]
Predicted Effect probably benign
Transcript: ENSMUST00000007708
AA Change: T324S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007708
Gene: ENSMUSG00000007564
AA Change: T324S

DomainStartEndE-ValueType
Pfam:HEAT 166 196 4.3e-6 PFAM
Pfam:HEAT_2 170 266 1.7e-8 PFAM
Pfam:HEAT 283 313 3.4e-5 PFAM
Pfam:HEAT_2 366 467 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139293
Predicted Effect probably benign
Transcript: ENSMUST00000147983
AA Change: T96S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133334
Gene: ENSMUSG00000007564
AA Change: T96S

DomainStartEndE-ValueType
Pfam:HEAT 13 43 2.1e-5 PFAM
Pfam:HEAT 52 82 2.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173359
Predicted Effect probably benign
Transcript: ENSMUST00000173658
SMART Domains Protein: ENSMUSP00000133778
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
PDB:2PF4|D 1 72 3e-40 PDB
SCOP:d1b3ua_ 2 86 3e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted allele that remove exons 5 and 6 exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased benzopyrene-induced lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Ppp2r1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp2r1a APN 17 20961578 unclassified probably benign
IGL01815:Ppp2r1a APN 17 20956832 missense probably benign 0.00
IGL01923:Ppp2r1a APN 17 20965469 makesense probably null
IGL02411:Ppp2r1a APN 17 20951334 splice site probably benign
IGL02694:Ppp2r1a APN 17 20951440 splice site probably benign
IGL02742:Ppp2r1a APN 17 20959003 missense probably benign 0.01
Altricial UTSW 17 20954717 critical splice donor site probably null
Dolmas UTSW 17 20960631 nonsense probably null
R0032:Ppp2r1a UTSW 17 20945584 critical splice donor site probably benign
R0403:Ppp2r1a UTSW 17 20957041 missense probably damaging 0.96
R1170:Ppp2r1a UTSW 17 20951331 splice site probably benign
R1652:Ppp2r1a UTSW 17 20955974 missense probably benign 0.03
R1857:Ppp2r1a UTSW 17 20961689 missense possibly damaging 0.93
R2215:Ppp2r1a UTSW 17 20961743 splice site probably null
R3800:Ppp2r1a UTSW 17 20962710 missense possibly damaging 0.82
R4013:Ppp2r1a UTSW 17 20951347 missense probably damaging 1.00
R4483:Ppp2r1a UTSW 17 20955810 missense probably benign 0.05
R5014:Ppp2r1a UTSW 17 20958839 splice site probably null
R5421:Ppp2r1a UTSW 17 20956706 missense probably benign
R5945:Ppp2r1a UTSW 17 20959413 missense possibly damaging 0.81
R5986:Ppp2r1a UTSW 17 20951346 missense probably damaging 1.00
R6466:Ppp2r1a UTSW 17 20960631 nonsense probably null
R6727:Ppp2r1a UTSW 17 20955825 missense probably benign 0.07
R6738:Ppp2r1a UTSW 17 20954717 critical splice donor site probably null
R6934:Ppp2r1a UTSW 17 20961633 missense possibly damaging 0.56
R7549:Ppp2r1a UTSW 17 20962682 missense possibly damaging 0.95
R7904:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7922:Ppp2r1a UTSW 17 20954617 missense probably benign
R7998:Ppp2r1a UTSW 17 20961639 missense possibly damaging 0.93
R8150:Ppp2r1a UTSW 17 20959438 missense possibly damaging 0.75
R8204:Ppp2r1a UTSW 17 20956773 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CTGATGAAGGACTGTGAGGC -3'
(R):5'- AGGGAACTCTGGTCTCTGAG -3'

Sequencing Primer
(F):5'- ACTGTGAGGCCGAGGTG -3'
(R):5'- TGGTCTCTGAGCAGTAAATACATCCC -3'
Posted On2016-10-26