Incidental Mutation 'R5615:Pcdhga12'
ID438220
Institutional Source Beutler Lab
Gene Symbol Pcdhga12
Ensembl Gene ENSMUSG00000102428
Gene Nameprotocadherin gamma subfamily A, 12
Synonymspc2c, Pcdh13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5615 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37765580-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37768079 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 655 (S655A)
Ref Sequence ENSEMBL: ENSMUSP00000036359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000044851] [ENSMUST00000061279] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193404] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000194928] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195764] [ENSMUST00000195823] [ENSMUST00000208907]
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044851
AA Change: S655A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036359
Gene: ENSMUSG00000102428
AA Change: S655A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
CA 45 131 3.28e-1 SMART
CA 155 240 1.8e-17 SMART
CA 264 345 9.22e-24 SMART
CA 369 450 1.28e-22 SMART
CA 474 560 1.09e-25 SMART
CA 591 669 9.24e-15 SMART
Pfam:Cadherin_C_2 688 772 3.6e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061279
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192501
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193045
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194928
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195764
SMART Domains Protein: ENSMUSP00000142272
Gene: ENSMUSG00000103081

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 57 132 1.5e-4 SMART
CA 156 241 1.2e-20 SMART
CA 265 346 7.8e-29 SMART
CA 370 451 1.7e-26 SMART
CA 475 561 2.2e-26 SMART
CA 592 673 6.4e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208907
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Pcdhga12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3946:Pcdhga12 UTSW 18 37767629 missense probably benign 0.00
R3964:Pcdhga12 UTSW 18 37767201 missense probably benign
R4169:Pcdhga12 UTSW 18 37766414 missense probably benign
R4363:Pcdhga12 UTSW 18 37766161 missense probably benign
R4409:Pcdhga12 UTSW 18 37768085 missense probably damaging 0.99
R4754:Pcdhga12 UTSW 18 37766551 missense probably damaging 1.00
R4863:Pcdhga12 UTSW 18 37768281 missense probably benign 0.36
R4890:Pcdhga12 UTSW 18 37768237 missense possibly damaging 0.72
R5029:Pcdhga12 UTSW 18 37766811 missense probably benign 0.11
R5114:Pcdhga12 UTSW 18 37768107 missense probably benign 0.10
R5274:Pcdhga12 UTSW 18 37766422 nonsense probably null
R5276:Pcdhga12 UTSW 18 37766675 missense possibly damaging 0.92
R5389:Pcdhga12 UTSW 18 37766732 missense probably damaging 1.00
R5454:Pcdhga12 UTSW 18 37766261 missense possibly damaging 0.46
R5704:Pcdhga12 UTSW 18 37767369 missense probably damaging 1.00
R5825:Pcdhga12 UTSW 18 37768503 missense possibly damaging 0.84
R5982:Pcdhga12 UTSW 18 37768031 missense probably damaging 1.00
R6810:Pcdhga12 UTSW 18 37767179 missense probably benign 0.00
R7330:Pcdhga12 UTSW 18 37768386 missense probably damaging 0.99
R7611:Pcdhga12 UTSW 18 37768425 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGCTATCTGGTGACAAAGG -3'
(R):5'- AAGTGAGAGGCTGCAACGTC -3'

Sequencing Primer
(F):5'- TGGCAGTGGACAGAGACTC -3'
(R):5'- GGCTGCAACGTCAGCCAATC -3'
Posted On2016-10-26