Incidental Mutation 'R5615:Nfkb2'
ID438223
Institutional Source Beutler Lab
Gene Symbol Nfkb2
Ensembl Gene ENSMUSG00000025225
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
SynonymsNF kappaB2, p52
Accession Numbers

Genbank: NM_019408; MGI: 1099800

Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R5615 (G1)
Quality Score218
Status Not validated
Chromosome19
Chromosomal Location46304737-46312090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46307567 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 170 (E170D)
Ref Sequence ENSEMBL: ENSMUSP00000107512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
AA Change: E170D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225
AA Change: E170D

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
AA Change: E170D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225
AA Change: E170D

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably benign
Transcript: ENSMUST00000225323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Chemically induced(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hspa12a T C 19: 58,804,650 I368V possibly damaging Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Nfkb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
xander APN 19 splice acceptor site
IGL01466:Nfkb2 APN 19 46308016 missense probably damaging 0.96
IGL01791:Nfkb2 APN 19 46309839 unclassified probably benign
IGL01966:Nfkb2 APN 19 46309690 missense probably benign 0.04
IGL03296:Nfkb2 APN 19 46309928 missense probably damaging 1.00
Dolores UTSW 19 46308223 missense possibly damaging 0.86
haze UTSW 19 46307434 missense possibly damaging 0.93
humbert UTSW 19 46307441 missense possibly damaging 0.86
lolita UTSW 19 46307720 critical splice donor site probably null
Nabukov UTSW 19 46308439 missense probably damaging 0.99
pale_fire UTSW 19 46311626 missense possibly damaging 0.96
Quilty UTSW 19 46308643 missense possibly damaging 0.64
R0270:Nfkb2 UTSW 19 46311626 missense possibly damaging 0.96
R0561:Nfkb2 UTSW 19 46309862 missense possibly damaging 0.93
R1944:Nfkb2 UTSW 19 46308052 missense probably damaging 1.00
R2217:Nfkb2 UTSW 19 46307724 splice site probably null
R2878:Nfkb2 UTSW 19 46307441 missense possibly damaging 0.86
R4493:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4494:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4495:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4731:Nfkb2 UTSW 19 46308964 missense possibly damaging 0.74
R4752:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4753:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4777:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4780:Nfkb2 UTSW 19 46309922 missense probably damaging 1.00
R4820:Nfkb2 UTSW 19 46308054 missense probably damaging 0.99
R4837:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4839:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5514:Nfkb2 UTSW 19 46311408 missense probably damaging 1.00
R5519:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5549:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5616:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5709:Nfkb2 UTSW 19 46310521 missense probably damaging 1.00
R6053:Nfkb2 UTSW 19 46311812 missense probably damaging 1.00
R6794:Nfkb2 UTSW 19 46307720 critical splice donor site probably null
R7539:Nfkb2 UTSW 19 46308223 missense possibly damaging 0.86
R7573:Nfkb2 UTSW 19 46308643 missense possibly damaging 0.64
R7963:Nfkb2 UTSW 19 46309919 missense possibly damaging 0.78
R8147:Nfkb2 UTSW 19 46307434 missense possibly damaging 0.93
R8153:Nfkb2 UTSW 19 46308016 missense probably damaging 0.96
R8241:Nfkb2 UTSW 19 46307615 missense probably benign 0.01
R8992:Nfkb2 UTSW 19 46306865 missense probably damaging 1.00
S24628:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
Z1177:Nfkb2 UTSW 19 46311590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGGTGTCCTGCATGTAAC -3'
(R):5'- TATCTCAAGCGCTCTTTTGGG -3'

Sequencing Primer
(F):5'- TGTCCTGCATGTAACCAAGAAG -3'
(R):5'- CAAGCGCTCTTTTGGGAATGC -3'
Posted On2016-10-26