Incidental Mutation 'R5615:Hspa12a'
ID 438224
Institutional Source Beutler Lab
Gene Symbol Hspa12a
Ensembl Gene ENSMUSG00000025092
Gene Name heat shock protein 12A
Synonyms 1700063D12Rik, Hspa12a
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R5615 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 58795751-58860984 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58804650 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 368 (I368V)
Ref Sequence ENSEMBL: ENSMUSP00000066860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066285]
AlphaFold Q8K0U4
Predicted Effect possibly damaging
Transcript: ENSMUST00000066285
AA Change: I368V

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066860
Gene: ENSMUSG00000025092
AA Change: I368V

DomainStartEndE-ValueType
SCOP:d1bupa1 58 244 4e-14 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,606,759 L407H probably damaging Het
Abca12 A T 1: 71,307,059 L884H probably damaging Het
Ahr A G 12: 35,503,885 V745A probably benign Het
Ankrd17 A T 5: 90,283,436 S830T possibly damaging Het
Aox1 A G 1: 58,096,966 T1123A probably benign Het
Arhgef11 T C 3: 87,722,485 probably null Het
Bcas3 T A 11: 85,470,761 C250S probably damaging Het
Bckdk T C 7: 127,907,317 I272T probably damaging Het
Cacna1e T C 1: 154,412,170 K1897E probably damaging Het
Cd180 A T 13: 102,706,203 I586F probably benign Het
Cep290 A G 10: 100,531,150 D1121G probably damaging Het
Clasrp A G 7: 19,586,447 probably benign Het
Col27a1 G T 4: 63,281,114 K912N probably damaging Het
Dock4 G T 12: 40,649,480 R231L probably benign Het
Ell G A 8: 70,590,732 S505N probably benign Het
Ephb6 A G 6: 41,619,291 T833A probably benign Het
Hemk1 T A 9: 107,330,824 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igkv3-3 A T 6: 70,687,230 T19S probably benign Het
Itpr1 G A 6: 108,488,600 A2158T possibly damaging Het
Lancl2 T C 6: 57,722,511 Y104H probably damaging Het
Leng8 G T 7: 4,144,958 E634* probably null Het
Lrrk1 A T 7: 66,287,615 C930S probably damaging Het
Lvrn C T 18: 46,850,328 S46L possibly damaging Het
Mcidas G A 13: 112,997,425 V148I probably benign Het
Mprip A T 11: 59,758,487 T1006S probably benign Het
Mrgprb3 T A 7: 48,643,486 M106L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor G A 4: 148,538,276 V1938I possibly damaging Het
Muc2 A G 7: 141,691,203 D46G probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1113 T A 2: 87,213,739 F282L probably benign Het
Olfr811 A T 10: 129,801,767 C253S probably damaging Het
Osbp2 C T 11: 3,863,356 G171D probably benign Het
Otud6b A T 4: 14,818,187 M238K possibly damaging Het
Pcdhac2 G A 18: 37,146,423 G819R probably benign Het
Pcdhac2 G T 18: 37,146,424 G819V probably benign Het
Pcdhga12 T G 18: 37,768,079 S655A probably damaging Het
Pkd1l3 A G 8: 109,630,210 I756V probably benign Het
Plekhd1 T A 12: 80,720,590 S251T probably damaging Het
Ppp2r1a A T 17: 20,958,987 T96S probably benign Het
Qser1 A C 2: 104,789,694 S258A possibly damaging Het
Rsph4a G A 10: 33,909,328 A412T probably benign Het
Sass6 T A 3: 116,607,486 C159S probably benign Het
Scaf4 T C 16: 90,251,960 Q322R unknown Het
Sema6d C T 2: 124,656,901 H244Y probably damaging Het
Sigirr T G 7: 141,092,719 L163F probably damaging Het
Spata31d1c C A 13: 65,035,264 L207I possibly damaging Het
Tacstd2 A G 6: 67,535,049 F220L probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnxb C A 17: 34,683,418 Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,807,365 probably benign Het
Trpm6 C T 19: 18,829,933 R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Vmn2r61 T A 7: 42,267,253 M430K probably benign Het
Zfp599 T C 9: 22,253,869 D70G probably benign Het
Zmym1 A T 4: 127,049,398 I301N probably damaging Het
Other mutations in Hspa12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Hspa12a APN 19 58828249 splice site probably null
IGL01516:Hspa12a APN 19 58827676 missense probably benign 0.00
IGL01766:Hspa12a APN 19 58799467 missense probably damaging 0.99
IGL01986:Hspa12a APN 19 58799402 missense probably benign 0.30
IGL02138:Hspa12a APN 19 58828298 missense probably benign 0.45
IGL02170:Hspa12a APN 19 58804681 missense probably benign 0.01
IGL02576:Hspa12a APN 19 58799410 missense possibly damaging 0.56
IGL02623:Hspa12a APN 19 58809551 missense probably benign 0.01
IGL02890:Hspa12a APN 19 58820999 critical splice donor site probably null
IGL03209:Hspa12a APN 19 58822061 splice site probably null
IGL03343:Hspa12a APN 19 58799396 missense probably benign 0.00
R0040:Hspa12a UTSW 19 58799624 missense probably benign 0.10
R0090:Hspa12a UTSW 19 58799509 missense probably benign 0.00
R2139:Hspa12a UTSW 19 58799482 missense probably benign
R4031:Hspa12a UTSW 19 58800857 missense probably benign 0.17
R4686:Hspa12a UTSW 19 58799749 missense possibly damaging 0.90
R4914:Hspa12a UTSW 19 58799452 missense probably damaging 1.00
R5046:Hspa12a UTSW 19 58799545 missense probably damaging 1.00
R5580:Hspa12a UTSW 19 58799660 missense probably benign 0.11
R5781:Hspa12a UTSW 19 58822086 missense probably damaging 0.99
R6777:Hspa12a UTSW 19 58822087 missense probably benign 0.03
R6954:Hspa12a UTSW 19 58799692 missense probably benign 0.05
R7038:Hspa12a UTSW 19 58804700 missense probably damaging 1.00
R7151:Hspa12a UTSW 19 58822162 missense probably benign 0.07
R7249:Hspa12a UTSW 19 58805433 missense probably benign 0.27
R7677:Hspa12a UTSW 19 58860885 missense probably benign 0.01
R8110:Hspa12a UTSW 19 58821013 missense possibly damaging 0.86
R8830:Hspa12a UTSW 19 58805463 missense possibly damaging 0.74
R8955:Hspa12a UTSW 19 58799626 missense probably damaging 1.00
R8987:Hspa12a UTSW 19 58799471 nonsense probably null
R9056:Hspa12a UTSW 19 58825288 missense probably damaging 1.00
R9147:Hspa12a UTSW 19 58805458 missense probably damaging 1.00
R9148:Hspa12a UTSW 19 58805458 missense probably damaging 1.00
R9157:Hspa12a UTSW 19 58800860 missense possibly damaging 0.86
R9316:Hspa12a UTSW 19 58804647 missense probably benign 0.22
R9329:Hspa12a UTSW 19 58800866 missense probably benign 0.01
R9370:Hspa12a UTSW 19 58825276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCATGCTCCACGCTGTG -3'
(R):5'- AGATCCCAAGGGTTTTGAGTG -3'

Sequencing Primer
(F):5'- GGCCCCGGAACTTCTTGTAGTAG -3'
(R):5'- AGTTGTCTGCGTGCCCAG -3'
Posted On 2016-10-26