Incidental Mutation 'R5579:Prrc2c'
ID438231
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission 043267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R5579 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 162680758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183223]
Predicted Effect probably null
Transcript: ENSMUST00000028016
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182149
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182393
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182535
Predicted Effect probably null
Transcript: ENSMUST00000182593
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182660
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183223
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,700,275 S345P probably benign Het
6430573F11Rik T C 8: 36,512,041 V266A probably benign Het
Abca3 G T 17: 24,376,729 C352F probably damaging Het
Abce1 A T 8: 79,700,586 I237N possibly damaging Het
Acrbp A G 6: 125,061,099 D421G probably benign Het
Adam8 T A 7: 139,988,984 Y201F probably benign Het
Adgrf1 T A 17: 43,311,064 C731S probably damaging Het
AF067063 T A 13: 119,828,415 M82L probably benign Het
Akap8l A T 17: 32,321,942 I529N probably damaging Het
Akap9 G A 5: 4,064,714 G114D possibly damaging Het
Alox12b T A 11: 69,162,932 D158E probably benign Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Ankrd42 T C 7: 92,590,182 Y466C possibly damaging Het
Apobr T C 7: 126,587,675 I786T probably benign Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Btnl1 T C 17: 34,381,552 probably null Het
Ccdc174 A G 6: 91,881,350 probably null Het
Ccdc183 T C 2: 25,615,422 D177G possibly damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cep162 G A 9: 87,203,671 A1200V probably benign Het
Clic3 T C 2: 25,458,307 L128P probably damaging Het
Cntnap5b A T 1: 100,383,395 R538* probably null Het
Cntnap5b A T 1: 100,383,399 Q539L probably benign Het
Coq7 A T 7: 118,517,335 N214K unknown Het
Cramp1l G A 17: 24,973,113 H1018Y possibly damaging Het
Crtac1 T A 19: 42,304,806 D288V probably damaging Het
Dab2ip C T 2: 35,715,327 R132* probably null Het
Dis3l C A 9: 64,330,835 C125F probably benign Het
Dnmt1 A T 9: 20,920,205 V543D probably damaging Het
Dock9 A T 14: 121,599,695 L67Q probably damaging Het
Ehbp1 A T 11: 22,137,846 S413T probably damaging Het
Endov A G 11: 119,505,097 I158V probably benign Het
Epb41l4b A G 4: 57,064,802 V469A possibly damaging Het
Etf1 G A 18: 34,913,601 P119S probably damaging Het
Fam135a A G 1: 24,029,727 L491P possibly damaging Het
Fancd2 A T 6: 113,560,051 probably null Het
Fank1 T A 7: 133,869,329 probably null Het
Fbxo18 A G 2: 11,748,993 I846T probably damaging Het
Gas2l3 T C 10: 89,414,066 T397A probably benign Het
Gga1 T C 15: 78,893,188 V513A probably damaging Het
Ggt1 T C 10: 75,585,948 V543A probably damaging Het
Gm11596 A T 11: 99,792,891 C134* probably null Het
Gnal C T 18: 67,088,771 R82C unknown Het
Hat1 T C 2: 71,410,238 V92A possibly damaging Het
Icosl C T 10: 78,073,763 R181C probably damaging Het
Ift46 A G 9: 44,786,863 M208V possibly damaging Het
Ighv1-26 T C 12: 114,788,599 K42E possibly damaging Het
Ipo5 A G 14: 120,938,613 K617E probably benign Het
Irx5 A G 8: 92,359,913 D208G probably benign Het
Itgal T G 7: 127,306,929 V397G probably benign Het
Itpr2 G A 6: 146,173,366 R2297* probably null Het
Itpr3 A G 17: 27,113,519 D1779G probably damaging Het
Krt4 T A 15: 101,921,234 E286D probably benign Het
Loxl4 C T 19: 42,604,290 G317E probably damaging Het
Mapk6 T G 9: 75,388,062 H718P possibly damaging Het
Mark2 A C 19: 7,282,816 V14G probably damaging Het
Mbd5 A G 2: 49,272,814 T1103A possibly damaging Het
Mcph1 A G 8: 18,632,293 E482G probably benign Het
Mme G A 3: 63,348,645 E509K probably damaging Het
Mrgbp A G 2: 180,585,483 T204A probably damaging Het
Mycbp2 A T 14: 103,291,333 F430I probably damaging Het
Myo6 A G 9: 80,217,720 D27G probably damaging Het
Ncoa6 A G 2: 155,406,677 L1569S probably damaging Het
Ndc1 T A 4: 107,380,704 F235Y possibly damaging Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Olfr1176 A T 2: 88,340,413 I283F possibly damaging Het
Olfr301 T A 7: 86,412,726 Y121* probably null Het
Olfr608 G A 7: 103,470,914 V292M probably damaging Het
Osbpl1a G T 18: 12,841,192 A62E probably damaging Het
Osbpl1a A C 18: 12,892,262 S333A probably benign Het
Otud4 C T 8: 79,664,108 T417I probably benign Het
Pagr1a T C 7: 127,015,442 E197G probably damaging Het
Pcdh18 T C 3: 49,744,977 Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,731,637 I162L probably benign Het
Pdpr T A 8: 111,123,816 Y462N probably damaging Het
Pkhd1 A T 1: 20,523,142 H1582Q probably damaging Het
Polr1b A G 2: 129,110,108 K352R probably damaging Het
Poteg G A 8: 27,448,037 V12M probably damaging Het
Pou2f1 A C 1: 165,915,162 V54G probably damaging Het
Ppme1 A G 7: 100,344,975 L177P probably damaging Het
Prkce A G 17: 86,619,948 D550G probably damaging Het
Ptpn22 A G 3: 103,882,139 probably null Het
Rabif G A 1: 134,506,205 V86M probably damaging Het
Rbm25 T A 12: 83,668,507 M484K probably benign Het
Rcn2 G A 9: 56,057,429 A224T probably benign Het
Rexo5 T A 7: 119,834,403 probably null Het
Rnase1 A T 14: 51,145,762 I45N probably benign Het
Rnmt T A 18: 68,306,115 D98E possibly damaging Het
Rprd2 A G 3: 95,785,059 F188L probably damaging Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Slc7a15 T C 12: 8,539,344 I68V probably benign Het
Slco1a5 A T 6: 142,242,125 V496D possibly damaging Het
Slitrk6 T G 14: 110,751,217 S353R possibly damaging Het
Smpd5 T A 15: 76,295,125 I53K possibly damaging Het
Tas2r108 T C 6: 40,494,087 S166P probably benign Het
Tecpr1 C A 5: 144,214,344 V245L possibly damaging Het
Tenm3 G T 8: 48,236,764 N1929K probably damaging Het
Tigd5 T G 15: 75,911,025 F412C probably damaging Het
Timm17a A T 1: 135,306,188 S74T possibly damaging Het
Tle1 A T 4: 72,139,808 L60Q probably damaging Het
Tmem132d T C 5: 127,796,000 E515G possibly damaging Het
Tmem65 T C 15: 58,794,397 N115S probably benign Het
Trmt5 C A 12: 73,281,652 R259L possibly damaging Het
Ttc37 T C 13: 76,185,200 W25R probably damaging Het
Vmn2r50 A T 7: 10,050,089 W153R probably benign Het
Vwa3a T G 7: 120,768,173 S184A probably benign Het
Zbtb25 A G 12: 76,349,164 L428P possibly damaging Het
Zbtb49 C T 5: 38,200,816 D698N probably damaging Het
Zbtb8os T G 4: 129,340,735 D35E probably damaging Het
Zfp316 T C 5: 143,264,491 T56A unknown Het
Zfp334 A T 2: 165,380,487 C545* probably null Het
Zmiz1 C A 14: 25,644,856 S247R probably damaging Het
Zscan18 A G 7: 12,775,381 probably benign Het
Zzef1 T C 11: 72,900,637 V2189A probably damaging Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162709669 unclassified probably benign
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4981:Prrc2c UTSW 1 162692547 missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5543:Prrc2c UTSW 1 162673511 missense probably damaging 0.99
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6142:Prrc2c UTSW 1 162710387 missense unknown
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6801:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162681281 missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162673517 missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162679974 missense possibly damaging 0.59
R7467:Prrc2c UTSW 1 162677363 missense possibly damaging 0.84
R7915:Prrc2c UTSW 1 162692408 missense probably benign 0.39
R8068:Prrc2c UTSW 1 162709061 unclassified probably benign
R8529:Prrc2c UTSW 1 162709094 unclassified probably benign
R8734:Prrc2c UTSW 1 162679512 missense possibly damaging 0.92
R8735:Prrc2c UTSW 1 162709558 missense unknown
R8813:Prrc2c UTSW 1 162705243 missense unknown
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGTCTTGAGACCAGTATGGGAG -3'
(R):5'- GGAGTACTGTTTTATTTTCCCAGTC -3'

Sequencing Primer
(F):5'- CTGCCTCCTGAGAATTGGGAATC -3'
(R):5'- AGGTTGTGTCTATATATTACATGTGC -3'
Posted On2016-10-26