Incidental Mutation 'R5579:Dab2ip'
ID 438237
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Name disabled 2 interacting protein
Synonyms 2310011D08Rik, AIP1
MMRRC Submission 043267-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R5579 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 35448285-35621006 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 35605339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 132 (R132*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000112992] [ENSMUST00000135741] [ENSMUST00000145698]
AlphaFold Q3UHC7
Predicted Effect probably null
Transcript: ENSMUST00000065001
AA Change: R442*
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883
AA Change: R442*

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091010
AA Change: R507*
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883
AA Change: R507*

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112983
AA Change: R383*
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883
AA Change: R383*

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112986
AA Change: R479*
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883
AA Change: R479*

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112987
AA Change: R450*
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883
AA Change: R450*

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112992
AA Change: R507*
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883
AA Change: R507*

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156669
AA Change: R132*
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883
AA Change: R132*

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124098
AA Change: R400*
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883
AA Change: R400*

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135741
AA Change: R450*
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: R450*

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G T 17: 24,595,703 (GRCm39) C352F probably damaging Het
Abce1 A T 8: 80,427,215 (GRCm39) I237N possibly damaging Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam8 T A 7: 139,568,897 (GRCm39) Y201F probably benign Het
Adgrf1 T A 17: 43,621,955 (GRCm39) C731S probably damaging Het
Akap8l A T 17: 32,540,916 (GRCm39) I529N probably damaging Het
Akap9 G A 5: 4,114,714 (GRCm39) G114D possibly damaging Het
Alox12b T A 11: 69,053,758 (GRCm39) D158E probably benign Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Ankrd42 T C 7: 92,239,390 (GRCm39) Y466C possibly damaging Het
Apobr T C 7: 126,186,847 (GRCm39) I786T probably benign Het
Arhgef12 C T 9: 42,921,489 (GRCm39) G329R probably benign Het
Btnl1 T C 17: 34,600,526 (GRCm39) probably null Het
Ccdc174 A G 6: 91,858,331 (GRCm39) probably null Het
Ccdc183 T C 2: 25,505,434 (GRCm39) D177G possibly damaging Het
Cd14 A G 18: 36,859,288 (GRCm39) Y56H probably benign Het
Cep162 G A 9: 87,085,724 (GRCm39) A1200V probably benign Het
Clic3 T C 2: 25,348,319 (GRCm39) L128P probably damaging Het
Cntnap5b A T 1: 100,311,120 (GRCm39) R538* probably null Het
Cntnap5b A T 1: 100,311,124 (GRCm39) Q539L probably benign Het
Coq7 A T 7: 118,116,558 (GRCm39) N214K unknown Het
Cramp1 G A 17: 25,192,087 (GRCm39) H1018Y possibly damaging Het
Crtac1 T A 19: 42,293,245 (GRCm39) D288V probably damaging Het
Dis3l C A 9: 64,238,117 (GRCm39) C125F probably benign Het
Dnmt1 A T 9: 20,831,501 (GRCm39) V543D probably damaging Het
Dock9 A T 14: 121,837,107 (GRCm39) L67Q probably damaging Het
Ehbp1 A T 11: 22,087,846 (GRCm39) S413T probably damaging Het
Endov A G 11: 119,395,923 (GRCm39) I158V probably benign Het
Epb41l4b A G 4: 57,064,802 (GRCm39) V469A possibly damaging Het
Etf1 G A 18: 35,046,654 (GRCm39) P119S probably damaging Het
Fam135a A G 1: 24,068,808 (GRCm39) L491P possibly damaging Het
Fancd2 A T 6: 113,537,012 (GRCm39) probably null Het
Fank1 T A 7: 133,471,058 (GRCm39) probably null Het
Fbh1 A G 2: 11,753,804 (GRCm39) I846T probably damaging Het
Gas2l3 T C 10: 89,249,928 (GRCm39) T397A probably benign Het
Gga1 T C 15: 78,777,388 (GRCm39) V513A probably damaging Het
Ggt1 T C 10: 75,421,782 (GRCm39) V543A probably damaging Het
Gm11596 A T 11: 99,683,717 (GRCm39) C134* probably null Het
Gnal C T 18: 67,221,842 (GRCm39) R82C unknown Het
Hat1 T C 2: 71,240,582 (GRCm39) V92A possibly damaging Het
Icosl C T 10: 77,909,597 (GRCm39) R181C probably damaging Het
Ift46 A G 9: 44,698,160 (GRCm39) M208V possibly damaging Het
Ighv1-26 T C 12: 114,752,219 (GRCm39) K42E possibly damaging Het
Ipo5 A G 14: 121,176,025 (GRCm39) K617E probably benign Het
Irx5 A G 8: 93,086,541 (GRCm39) D208G probably benign Het
Itgal T G 7: 126,906,101 (GRCm39) V397G probably benign Het
Itpr2 G A 6: 146,074,864 (GRCm39) R2297* probably null Het
Itpr3 A G 17: 27,332,493 (GRCm39) D1779G probably damaging Het
Khdc4 T C 3: 88,607,582 (GRCm39) S345P probably benign Het
Krt4 T A 15: 101,829,669 (GRCm39) E286D probably benign Het
Loxl4 C T 19: 42,592,729 (GRCm39) G317E probably damaging Het
Mapk6 T G 9: 75,295,344 (GRCm39) H718P possibly damaging Het
Mark2 A C 19: 7,260,181 (GRCm39) V14G probably damaging Het
Mbd5 A G 2: 49,162,826 (GRCm39) T1103A possibly damaging Het
Mcph1 A G 8: 18,682,309 (GRCm39) E482G probably benign Het
Mme G A 3: 63,256,066 (GRCm39) E509K probably damaging Het
Mrgbp A G 2: 180,227,276 (GRCm39) T204A probably damaging Het
Mycbp2 A T 14: 103,528,769 (GRCm39) F430I probably damaging Het
Myo6 A G 9: 80,125,002 (GRCm39) D27G probably damaging Het
Ncoa6 A G 2: 155,248,597 (GRCm39) L1569S probably damaging Het
Ndc1 T A 4: 107,237,901 (GRCm39) F235Y possibly damaging Het
Nmur2 A T 11: 55,923,835 (GRCm39) S240T probably benign Het
Or14c44 T A 7: 86,061,934 (GRCm39) Y121* probably null Het
Or52ae7 G A 7: 103,120,121 (GRCm39) V292M probably damaging Het
Or5d46 A T 2: 88,170,757 (GRCm39) I283F possibly damaging Het
Osbpl1a G T 18: 12,974,249 (GRCm39) A62E probably damaging Het
Osbpl1a A C 18: 13,025,319 (GRCm39) S333A probably benign Het
Otud4 C T 8: 80,390,737 (GRCm39) T417I probably benign Het
Pagr1a T C 7: 126,614,614 (GRCm39) E197G probably damaging Het
Pcdh18 T C 3: 49,699,426 (GRCm39) Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,864,690 (GRCm39) I162L probably benign Het
Pdpr T A 8: 111,850,448 (GRCm39) Y462N probably damaging Het
Pkhd1 A T 1: 20,593,366 (GRCm39) H1582Q probably damaging Het
Polr1b A G 2: 128,952,028 (GRCm39) K352R probably damaging Het
Poteg G A 8: 27,938,065 (GRCm39) V12M probably damaging Het
Pou2f1 A C 1: 165,742,731 (GRCm39) V54G probably damaging Het
Ppme1 A G 7: 99,994,182 (GRCm39) L177P probably damaging Het
Prkce A G 17: 86,927,376 (GRCm39) D550G probably damaging Het
Prrc2c A G 1: 162,508,327 (GRCm39) probably null Het
Ptpn22 A G 3: 103,789,455 (GRCm39) probably null Het
Rabif G A 1: 134,433,943 (GRCm39) V86M probably damaging Het
Rbm25 T A 12: 83,715,281 (GRCm39) M484K probably benign Het
Rcn2 G A 9: 55,964,713 (GRCm39) A224T probably benign Het
Rexo5 T A 7: 119,433,626 (GRCm39) probably null Het
Rnase1 A T 14: 51,383,219 (GRCm39) I45N probably benign Het
Rnmt T A 18: 68,439,186 (GRCm39) D98E possibly damaging Het
Rprd2 A G 3: 95,692,371 (GRCm39) F188L probably damaging Het
Scube2 G A 7: 109,409,944 (GRCm39) T643M probably damaging Het
Skic3 T C 13: 76,333,319 (GRCm39) W25R probably damaging Het
Slc7a15 T C 12: 8,589,344 (GRCm39) I68V probably benign Het
Slco1a5 A T 6: 142,187,851 (GRCm39) V496D possibly damaging Het
Slitrk6 T G 14: 110,988,649 (GRCm39) S353R possibly damaging Het
Smpd5 T A 15: 76,179,325 (GRCm39) I53K possibly damaging Het
Tas2r108 T C 6: 40,471,021 (GRCm39) S166P probably benign Het
Tcstv7a T A 13: 120,289,951 (GRCm39) M82L probably benign Het
Tecpr1 C A 5: 144,151,162 (GRCm39) V245L possibly damaging Het
Tenm3 G T 8: 48,689,799 (GRCm39) N1929K probably damaging Het
Tigd5 T G 15: 75,782,874 (GRCm39) F412C probably damaging Het
Timm17a A T 1: 135,233,926 (GRCm39) S74T possibly damaging Het
Tle1 A T 4: 72,058,045 (GRCm39) L60Q probably damaging Het
Tmem132d T C 5: 127,873,064 (GRCm39) E515G possibly damaging Het
Tmem65 T C 15: 58,666,246 (GRCm39) N115S probably benign Het
Trmt5 C A 12: 73,328,426 (GRCm39) R259L possibly damaging Het
Trmt9b T C 8: 36,979,195 (GRCm39) V266A probably benign Het
Vmn2r50 A T 7: 9,784,016 (GRCm39) W153R probably benign Het
Vwa3a T G 7: 120,367,396 (GRCm39) S184A probably benign Het
Zbtb25 A G 12: 76,395,938 (GRCm39) L428P possibly damaging Het
Zbtb49 C T 5: 38,358,160 (GRCm39) D698N probably damaging Het
Zbtb8os T G 4: 129,234,528 (GRCm39) D35E probably damaging Het
Zfp316 T C 5: 143,250,246 (GRCm39) T56A unknown Het
Zfp334 A T 2: 165,222,407 (GRCm39) C545* probably null Het
Zmiz1 C A 14: 25,645,280 (GRCm39) S247R probably damaging Het
Zscan18 A G 7: 12,509,308 (GRCm39) probably benign Het
Zzef1 T C 11: 72,791,463 (GRCm39) V2189A probably damaging Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35,610,025 (GRCm39) missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35,597,787 (GRCm39) missense probably benign 0.25
IGL00902:Dab2ip APN 2 35,607,124 (GRCm39) missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35,598,889 (GRCm39) missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35,533,909 (GRCm39) missense probably benign 0.27
R0097:Dab2ip UTSW 2 35,608,928 (GRCm39) missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35,582,388 (GRCm39) critical splice donor site probably null
R0184:Dab2ip UTSW 2 35,608,803 (GRCm39) missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35,608,757 (GRCm39) splice site probably benign
R1195:Dab2ip UTSW 2 35,608,757 (GRCm39) splice site probably benign
R1388:Dab2ip UTSW 2 35,611,268 (GRCm39) intron probably benign
R1442:Dab2ip UTSW 2 35,600,268 (GRCm39) missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35,608,803 (GRCm39) missense probably damaging 1.00
R1665:Dab2ip UTSW 2 35,610,290 (GRCm39) missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35,608,827 (GRCm39) missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35,533,903 (GRCm39) nonsense probably null
R3819:Dab2ip UTSW 2 35,603,222 (GRCm39) missense probably damaging 1.00
R4333:Dab2ip UTSW 2 35,551,632 (GRCm39) makesense probably null
R4869:Dab2ip UTSW 2 35,610,049 (GRCm39) missense probably damaging 1.00
R4894:Dab2ip UTSW 2 35,620,539 (GRCm39) utr 3 prime probably benign
R5035:Dab2ip UTSW 2 35,599,953 (GRCm39) missense probably benign 0.03
R5180:Dab2ip UTSW 2 35,610,503 (GRCm39) missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35,600,003 (GRCm39) missense probably benign 0.25
R5513:Dab2ip UTSW 2 35,600,266 (GRCm39) missense probably benign 0.11
R5829:Dab2ip UTSW 2 35,597,787 (GRCm39) unclassified probably benign
R5840:Dab2ip UTSW 2 35,617,511 (GRCm39) missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35,605,414 (GRCm39) missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35,582,267 (GRCm39) nonsense probably null
R6235:Dab2ip UTSW 2 35,613,099 (GRCm39) missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35,600,278 (GRCm39) missense probably benign 0.38
R6571:Dab2ip UTSW 2 35,602,902 (GRCm39) missense probably damaging 1.00
R6813:Dab2ip UTSW 2 35,620,485 (GRCm39) nonsense probably null
R7262:Dab2ip UTSW 2 35,512,298 (GRCm39) splice site probably null
R7883:Dab2ip UTSW 2 35,610,218 (GRCm39) missense possibly damaging 0.51
R8127:Dab2ip UTSW 2 35,534,138 (GRCm39) critical splice donor site probably benign
R8313:Dab2ip UTSW 2 35,617,440 (GRCm39) missense probably damaging 1.00
R8387:Dab2ip UTSW 2 35,609,870 (GRCm39) missense probably damaging 0.97
R8422:Dab2ip UTSW 2 35,597,767 (GRCm39) missense probably damaging 0.97
R8560:Dab2ip UTSW 2 35,603,144 (GRCm39) missense probably damaging 1.00
R9263:Dab2ip UTSW 2 35,602,891 (GRCm39) missense probably damaging 1.00
R9342:Dab2ip UTSW 2 35,613,105 (GRCm39) missense possibly damaging 0.75
R9353:Dab2ip UTSW 2 35,598,851 (GRCm39) missense probably damaging 1.00
R9423:Dab2ip UTSW 2 35,599,966 (GRCm39) missense probably damaging 1.00
R9551:Dab2ip UTSW 2 35,605,330 (GRCm39) missense possibly damaging 0.60
R9563:Dab2ip UTSW 2 35,609,915 (GRCm39) nonsense probably null
X0011:Dab2ip UTSW 2 35,613,097 (GRCm39) nonsense probably null
Z1176:Dab2ip UTSW 2 35,598,880 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTTCGTGGCTGCAGAGC -3'
(R):5'- ATGCACCAAGTTTCTGTCCC -3'

Sequencing Primer
(F):5'- GCCCTGAGCTCATTCCAC -3'
(R):5'- CACTCACTTGGCAAAGTTGG -3'
Posted On 2016-10-26