Incidental Mutation 'R5579:Ncoa6'
ID438244
Institutional Source Beutler Lab
Gene Symbol Ncoa6
Ensembl Gene ENSMUSG00000038369
Gene Namenuclear receptor coactivator 6
SynonymsPRIP, ASC-2, NRC, AIB3, RAP250, ASC2
MMRRC Submission 043267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5579 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155390656-155473894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155406677 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 1569 (L1569S)
Ref Sequence ENSEMBL: ENSMUSP00000105295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109670] [ENSMUST00000123293]
Predicted Effect probably damaging
Transcript: ENSMUST00000043126
AA Change: L1569S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: L1569S

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109670
AA Change: L1569S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: L1569S

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123293
SMART Domains Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 2.4e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
low complexity region 564 573 N/A INTRINSIC
low complexity region 615 630 N/A INTRINSIC
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146942
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,700,275 S345P probably benign Het
6430573F11Rik T C 8: 36,512,041 V266A probably benign Het
Abca3 G T 17: 24,376,729 C352F probably damaging Het
Abce1 A T 8: 79,700,586 I237N possibly damaging Het
Acrbp A G 6: 125,061,099 D421G probably benign Het
Adam8 T A 7: 139,988,984 Y201F probably benign Het
Adgrf1 T A 17: 43,311,064 C731S probably damaging Het
AF067063 T A 13: 119,828,415 M82L probably benign Het
Akap8l A T 17: 32,321,942 I529N probably damaging Het
Akap9 G A 5: 4,064,714 G114D possibly damaging Het
Alox12b T A 11: 69,162,932 D158E probably benign Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Ankrd42 T C 7: 92,590,182 Y466C possibly damaging Het
Apobr T C 7: 126,587,675 I786T probably benign Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Btnl1 T C 17: 34,381,552 probably null Het
Ccdc174 A G 6: 91,881,350 probably null Het
Ccdc183 T C 2: 25,615,422 D177G possibly damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cep162 G A 9: 87,203,671 A1200V probably benign Het
Clic3 T C 2: 25,458,307 L128P probably damaging Het
Cntnap5b A T 1: 100,383,395 R538* probably null Het
Cntnap5b A T 1: 100,383,399 Q539L probably benign Het
Coq7 A T 7: 118,517,335 N214K unknown Het
Cramp1l G A 17: 24,973,113 H1018Y possibly damaging Het
Crtac1 T A 19: 42,304,806 D288V probably damaging Het
Dab2ip C T 2: 35,715,327 R132* probably null Het
Dis3l C A 9: 64,330,835 C125F probably benign Het
Dnmt1 A T 9: 20,920,205 V543D probably damaging Het
Dock9 A T 14: 121,599,695 L67Q probably damaging Het
Ehbp1 A T 11: 22,137,846 S413T probably damaging Het
Endov A G 11: 119,505,097 I158V probably benign Het
Epb41l4b A G 4: 57,064,802 V469A possibly damaging Het
Etf1 G A 18: 34,913,601 P119S probably damaging Het
Fam135a A G 1: 24,029,727 L491P possibly damaging Het
Fancd2 A T 6: 113,560,051 probably null Het
Fank1 T A 7: 133,869,329 probably null Het
Fbxo18 A G 2: 11,748,993 I846T probably damaging Het
Gas2l3 T C 10: 89,414,066 T397A probably benign Het
Gga1 T C 15: 78,893,188 V513A probably damaging Het
Ggt1 T C 10: 75,585,948 V543A probably damaging Het
Gm11596 A T 11: 99,792,891 C134* probably null Het
Gnal C T 18: 67,088,771 R82C unknown Het
Hat1 T C 2: 71,410,238 V92A possibly damaging Het
Icosl C T 10: 78,073,763 R181C probably damaging Het
Ift46 A G 9: 44,786,863 M208V possibly damaging Het
Ighv1-26 T C 12: 114,788,599 K42E possibly damaging Het
Ipo5 A G 14: 120,938,613 K617E probably benign Het
Irx5 A G 8: 92,359,913 D208G probably benign Het
Itgal T G 7: 127,306,929 V397G probably benign Het
Itpr2 G A 6: 146,173,366 R2297* probably null Het
Itpr3 A G 17: 27,113,519 D1779G probably damaging Het
Krt4 T A 15: 101,921,234 E286D probably benign Het
Loxl4 C T 19: 42,604,290 G317E probably damaging Het
Mapk6 T G 9: 75,388,062 H718P possibly damaging Het
Mark2 A C 19: 7,282,816 V14G probably damaging Het
Mbd5 A G 2: 49,272,814 T1103A possibly damaging Het
Mcph1 A G 8: 18,632,293 E482G probably benign Het
Mme G A 3: 63,348,645 E509K probably damaging Het
Mrgbp A G 2: 180,585,483 T204A probably damaging Het
Mycbp2 A T 14: 103,291,333 F430I probably damaging Het
Myo6 A G 9: 80,217,720 D27G probably damaging Het
Ndc1 T A 4: 107,380,704 F235Y possibly damaging Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Olfr1176 A T 2: 88,340,413 I283F possibly damaging Het
Olfr301 T A 7: 86,412,726 Y121* probably null Het
Olfr608 G A 7: 103,470,914 V292M probably damaging Het
Osbpl1a G T 18: 12,841,192 A62E probably damaging Het
Osbpl1a A C 18: 12,892,262 S333A probably benign Het
Otud4 C T 8: 79,664,108 T417I probably benign Het
Pagr1a T C 7: 127,015,442 E197G probably damaging Het
Pcdh18 T C 3: 49,744,977 Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,731,637 I162L probably benign Het
Pdpr T A 8: 111,123,816 Y462N probably damaging Het
Pkhd1 A T 1: 20,523,142 H1582Q probably damaging Het
Polr1b A G 2: 129,110,108 K352R probably damaging Het
Poteg G A 8: 27,448,037 V12M probably damaging Het
Pou2f1 A C 1: 165,915,162 V54G probably damaging Het
Ppme1 A G 7: 100,344,975 L177P probably damaging Het
Prkce A G 17: 86,619,948 D550G probably damaging Het
Prrc2c A G 1: 162,680,758 probably null Het
Ptpn22 A G 3: 103,882,139 probably null Het
Rabif G A 1: 134,506,205 V86M probably damaging Het
Rbm25 T A 12: 83,668,507 M484K probably benign Het
Rcn2 G A 9: 56,057,429 A224T probably benign Het
Rexo5 T A 7: 119,834,403 probably null Het
Rnase1 A T 14: 51,145,762 I45N probably benign Het
Rnmt T A 18: 68,306,115 D98E possibly damaging Het
Rprd2 A G 3: 95,785,059 F188L probably damaging Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Slc7a15 T C 12: 8,539,344 I68V probably benign Het
Slco1a5 A T 6: 142,242,125 V496D possibly damaging Het
Slitrk6 T G 14: 110,751,217 S353R possibly damaging Het
Smpd5 T A 15: 76,295,125 I53K possibly damaging Het
Tas2r108 T C 6: 40,494,087 S166P probably benign Het
Tecpr1 C A 5: 144,214,344 V245L possibly damaging Het
Tenm3 G T 8: 48,236,764 N1929K probably damaging Het
Tigd5 T G 15: 75,911,025 F412C probably damaging Het
Timm17a A T 1: 135,306,188 S74T possibly damaging Het
Tle1 A T 4: 72,139,808 L60Q probably damaging Het
Tmem132d T C 5: 127,796,000 E515G possibly damaging Het
Tmem65 T C 15: 58,794,397 N115S probably benign Het
Trmt5 C A 12: 73,281,652 R259L possibly damaging Het
Ttc37 T C 13: 76,185,200 W25R probably damaging Het
Vmn2r50 A T 7: 10,050,089 W153R probably benign Het
Vwa3a T G 7: 120,768,173 S184A probably benign Het
Zbtb25 A G 12: 76,349,164 L428P possibly damaging Het
Zbtb49 C T 5: 38,200,816 D698N probably damaging Het
Zbtb8os T G 4: 129,340,735 D35E probably damaging Het
Zfp316 T C 5: 143,264,491 T56A unknown Het
Zfp334 A T 2: 165,380,487 C545* probably null Het
Zmiz1 C A 14: 25,644,856 S247R probably damaging Het
Zscan18 A G 7: 12,775,381 probably benign Het
Zzef1 T C 11: 72,900,637 V2189A probably damaging Het
Other mutations in Ncoa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ncoa6 APN 2 155406208 missense probably damaging 0.99
IGL00849:Ncoa6 APN 2 155421688 missense possibly damaging 0.89
IGL00933:Ncoa6 APN 2 155415397 missense probably damaging 1.00
IGL00981:Ncoa6 APN 2 155406179 missense probably damaging 0.98
IGL01420:Ncoa6 APN 2 155407587 missense probably damaging 1.00
IGL02160:Ncoa6 APN 2 155421083 missense possibly damaging 0.65
IGL03049:Ncoa6 APN 2 155419014 missense probably damaging 1.00
IGL03194:Ncoa6 APN 2 155415868 missense possibly damaging 0.94
IGL03269:Ncoa6 APN 2 155406489 missense probably damaging 0.97
IGL03299:Ncoa6 APN 2 155407287 missense probably damaging 0.97
IGL03306:Ncoa6 APN 2 155405507 missense probably benign 0.30
alcoa UTSW 2 155402664 unclassified probably benign
Aluminum UTSW 2 155399693 critical splice acceptor site probably null
balboa UTSW 2 155406949 missense probably benign 0.05
mauna_loa UTSW 2 155415227 missense probably damaging 0.99
PIT4466001:Ncoa6 UTSW 2 155405657 missense probably benign
R0011:Ncoa6 UTSW 2 155408291 frame shift probably null
R0014:Ncoa6 UTSW 2 155438043 missense possibly damaging 0.86
R0079:Ncoa6 UTSW 2 155408291 frame shift probably null
R0080:Ncoa6 UTSW 2 155408291 frame shift probably null
R0081:Ncoa6 UTSW 2 155408291 frame shift probably null
R0164:Ncoa6 UTSW 2 155408291 frame shift probably null
R0166:Ncoa6 UTSW 2 155408291 frame shift probably null
R0172:Ncoa6 UTSW 2 155408291 frame shift probably null
R0173:Ncoa6 UTSW 2 155408291 frame shift probably null
R0245:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0284:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155415701 missense probably damaging 0.96
R0288:Ncoa6 UTSW 2 155408291 frame shift probably null
R0539:Ncoa6 UTSW 2 155415697 missense probably benign 0.08
R0652:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0781:Ncoa6 UTSW 2 155411520 splice site probably benign
R1053:Ncoa6 UTSW 2 155434040 missense probably damaging 1.00
R1110:Ncoa6 UTSW 2 155411520 splice site probably benign
R1420:Ncoa6 UTSW 2 155421153 nonsense probably null
R1521:Ncoa6 UTSW 2 155415222 missense possibly damaging 0.78
R1541:Ncoa6 UTSW 2 155415304 missense probably benign 0.35
R1677:Ncoa6 UTSW 2 155402664 unclassified probably benign
R1858:Ncoa6 UTSW 2 155421639 missense probably benign 0.13
R1954:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R1955:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R2040:Ncoa6 UTSW 2 155406080 missense probably damaging 0.98
R2087:Ncoa6 UTSW 2 155406159 nonsense probably null
R2159:Ncoa6 UTSW 2 155407713 missense probably damaging 1.00
R2278:Ncoa6 UTSW 2 155407650 missense possibly damaging 0.94
R2696:Ncoa6 UTSW 2 155438015 missense probably benign 0.45
R2891:Ncoa6 UTSW 2 155437961 missense possibly damaging 0.86
R3618:Ncoa6 UTSW 2 155407789 missense possibly damaging 0.95
R3747:Ncoa6 UTSW 2 155411641 missense probably benign 0.01
R3778:Ncoa6 UTSW 2 155421195 missense probably damaging 1.00
R3784:Ncoa6 UTSW 2 155407757 missense probably damaging 1.00
R3802:Ncoa6 UTSW 2 155405564 missense probably benign
R3820:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3821:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3822:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3870:Ncoa6 UTSW 2 155415557 splice site probably null
R4037:Ncoa6 UTSW 2 155407370 missense probably damaging 0.98
R4488:Ncoa6 UTSW 2 155407476 missense possibly damaging 0.94
R4719:Ncoa6 UTSW 2 155391161 unclassified probably benign
R4732:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4733:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4829:Ncoa6 UTSW 2 155415227 missense probably damaging 0.99
R4835:Ncoa6 UTSW 2 155407133 missense possibly damaging 0.46
R4883:Ncoa6 UTSW 2 155406767 missense probably benign 0.29
R4967:Ncoa6 UTSW 2 155421332 missense possibly damaging 0.80
R5021:Ncoa6 UTSW 2 155406949 missense probably benign 0.05
R5234:Ncoa6 UTSW 2 155438013 missense probably benign 0.01
R5356:Ncoa6 UTSW 2 155421192 missense probably damaging 0.99
R5358:Ncoa6 UTSW 2 155406987 missense probably damaging 0.97
R5375:Ncoa6 UTSW 2 155433995 missense probably benign 0.16
R5412:Ncoa6 UTSW 2 155407781 missense possibly damaging 0.95
R5618:Ncoa6 UTSW 2 155437897 missense possibly damaging 0.86
R5641:Ncoa6 UTSW 2 155421836 missense probably benign 0.22
R5757:Ncoa6 UTSW 2 155411608 missense probably damaging 1.00
R5761:Ncoa6 UTSW 2 155408141 missense probably benign 0.11
R5778:Ncoa6 UTSW 2 155406768 missense probably benign 0.01
R5852:Ncoa6 UTSW 2 155405499 missense possibly damaging 0.88
R5940:Ncoa6 UTSW 2 155415865 missense probably damaging 0.98
R6155:Ncoa6 UTSW 2 155407448 missense probably damaging 1.00
R6374:Ncoa6 UTSW 2 155421156 missense probably damaging 1.00
R6389:Ncoa6 UTSW 2 155395816 missense probably damaging 0.98
R6669:Ncoa6 UTSW 2 155399693 critical splice acceptor site probably null
R7097:Ncoa6 UTSW 2 155438063 missense probably benign 0.01
R7385:Ncoa6 UTSW 2 155407801 missense probably damaging 1.00
R7963:Ncoa6 UTSW 2 155405996 missense probably benign 0.30
R8356:Ncoa6 UTSW 2 155406252 missense possibly damaging 0.59
R8698:Ncoa6 UTSW 2 155415121 missense possibly damaging 0.94
RF033:Ncoa6 UTSW 2 155421731 small deletion probably benign
RF040:Ncoa6 UTSW 2 155421731 small deletion probably benign
RF048:Ncoa6 UTSW 2 155421712 small deletion probably benign
X0017:Ncoa6 UTSW 2 155406540 missense probably benign 0.05
Z1176:Ncoa6 UTSW 2 155421302 missense probably damaging 0.99
Z1177:Ncoa6 UTSW 2 155406142 missense possibly damaging 0.67
Z1177:Ncoa6 UTSW 2 155421218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTGACATCAATGCAGACTG -3'
(R):5'- TTCTTGACAACTCTGGAGCTCC -3'

Sequencing Primer
(F):5'- CAGACTGCAAGTGAGTTGGC -3'
(R):5'- GACAACTCTGGAGCTCCTAATGTG -3'
Posted On2016-10-26