Incidental Mutation 'R5579:Tle1'
ID 438256
Institutional Source Beutler Lab
Gene Symbol Tle1
Ensembl Gene ENSMUSG00000008305
Gene Name transducin-like enhancer of split 1
Synonyms C230057C06Rik, Estm14, Grg1, Tle4l
MMRRC Submission 043267-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.575) question?
Stock # R5579 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 72035379-72119156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72058045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 60 (L60Q)
Ref Sequence ENSEMBL: ENSMUSP00000118513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030095] [ENSMUST00000072695] [ENSMUST00000074216] [ENSMUST00000102848] [ENSMUST00000140154]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000030095
AA Change: L323Q

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030095
Gene: ENSMUSG00000008305
AA Change: L323Q

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 9.1e-77 PFAM
low complexity region 155 183 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
WD40 484 521 4.18e-2 SMART
WD40 527 568 1.03e-1 SMART
WD40 573 612 9.38e-5 SMART
WD40 615 654 1.14e-8 SMART
WD40 657 695 3.07e1 SMART
WD40 697 736 8.96e-2 SMART
WD40 737 777 4.14e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072695
AA Change: L313Q

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072481
Gene: ENSMUSG00000008305
AA Change: L313Q

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.6e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074216
AA Change: L313Q

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073839
Gene: ENSMUSG00000008305
AA Change: L313Q

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 1.3e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102848
AA Change: L321Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099912
Gene: ENSMUSG00000008305
AA Change: L321Q

DomainStartEndE-ValueType
Pfam:TLE_N 1 144 1.3e-76 PFAM
low complexity region 153 181 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 290 312 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
WD40 481 518 4.18e-2 SMART
WD40 524 565 1.03e-1 SMART
WD40 570 609 9.38e-5 SMART
WD40 612 651 1.14e-8 SMART
WD40 654 692 3.07e1 SMART
WD40 694 733 8.96e-2 SMART
WD40 734 774 4.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132550
Predicted Effect probably damaging
Transcript: ENSMUST00000140154
AA Change: L60Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118513
Gene: ENSMUSG00000008305
AA Change: L60Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G T 17: 24,595,703 (GRCm39) C352F probably damaging Het
Abce1 A T 8: 80,427,215 (GRCm39) I237N possibly damaging Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam8 T A 7: 139,568,897 (GRCm39) Y201F probably benign Het
Adgrf1 T A 17: 43,621,955 (GRCm39) C731S probably damaging Het
Akap8l A T 17: 32,540,916 (GRCm39) I529N probably damaging Het
Akap9 G A 5: 4,114,714 (GRCm39) G114D possibly damaging Het
Alox12b T A 11: 69,053,758 (GRCm39) D158E probably benign Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Ankrd42 T C 7: 92,239,390 (GRCm39) Y466C possibly damaging Het
Apobr T C 7: 126,186,847 (GRCm39) I786T probably benign Het
Arhgef12 C T 9: 42,921,489 (GRCm39) G329R probably benign Het
Btnl1 T C 17: 34,600,526 (GRCm39) probably null Het
Ccdc174 A G 6: 91,858,331 (GRCm39) probably null Het
Ccdc183 T C 2: 25,505,434 (GRCm39) D177G possibly damaging Het
Cd14 A G 18: 36,859,288 (GRCm39) Y56H probably benign Het
Cep162 G A 9: 87,085,724 (GRCm39) A1200V probably benign Het
Clic3 T C 2: 25,348,319 (GRCm39) L128P probably damaging Het
Cntnap5b A T 1: 100,311,120 (GRCm39) R538* probably null Het
Cntnap5b A T 1: 100,311,124 (GRCm39) Q539L probably benign Het
Coq7 A T 7: 118,116,558 (GRCm39) N214K unknown Het
Cramp1 G A 17: 25,192,087 (GRCm39) H1018Y possibly damaging Het
Crtac1 T A 19: 42,293,245 (GRCm39) D288V probably damaging Het
Dab2ip C T 2: 35,605,339 (GRCm39) R132* probably null Het
Dis3l C A 9: 64,238,117 (GRCm39) C125F probably benign Het
Dnmt1 A T 9: 20,831,501 (GRCm39) V543D probably damaging Het
Dock9 A T 14: 121,837,107 (GRCm39) L67Q probably damaging Het
Ehbp1 A T 11: 22,087,846 (GRCm39) S413T probably damaging Het
Endov A G 11: 119,395,923 (GRCm39) I158V probably benign Het
Epb41l4b A G 4: 57,064,802 (GRCm39) V469A possibly damaging Het
Etf1 G A 18: 35,046,654 (GRCm39) P119S probably damaging Het
Fam135a A G 1: 24,068,808 (GRCm39) L491P possibly damaging Het
Fancd2 A T 6: 113,537,012 (GRCm39) probably null Het
Fank1 T A 7: 133,471,058 (GRCm39) probably null Het
Fbh1 A G 2: 11,753,804 (GRCm39) I846T probably damaging Het
Gas2l3 T C 10: 89,249,928 (GRCm39) T397A probably benign Het
Gga1 T C 15: 78,777,388 (GRCm39) V513A probably damaging Het
Ggt1 T C 10: 75,421,782 (GRCm39) V543A probably damaging Het
Gm11596 A T 11: 99,683,717 (GRCm39) C134* probably null Het
Gnal C T 18: 67,221,842 (GRCm39) R82C unknown Het
Hat1 T C 2: 71,240,582 (GRCm39) V92A possibly damaging Het
Icosl C T 10: 77,909,597 (GRCm39) R181C probably damaging Het
Ift46 A G 9: 44,698,160 (GRCm39) M208V possibly damaging Het
Ighv1-26 T C 12: 114,752,219 (GRCm39) K42E possibly damaging Het
Ipo5 A G 14: 121,176,025 (GRCm39) K617E probably benign Het
Irx5 A G 8: 93,086,541 (GRCm39) D208G probably benign Het
Itgal T G 7: 126,906,101 (GRCm39) V397G probably benign Het
Itpr2 G A 6: 146,074,864 (GRCm39) R2297* probably null Het
Itpr3 A G 17: 27,332,493 (GRCm39) D1779G probably damaging Het
Khdc4 T C 3: 88,607,582 (GRCm39) S345P probably benign Het
Krt4 T A 15: 101,829,669 (GRCm39) E286D probably benign Het
Loxl4 C T 19: 42,592,729 (GRCm39) G317E probably damaging Het
Mapk6 T G 9: 75,295,344 (GRCm39) H718P possibly damaging Het
Mark2 A C 19: 7,260,181 (GRCm39) V14G probably damaging Het
Mbd5 A G 2: 49,162,826 (GRCm39) T1103A possibly damaging Het
Mcph1 A G 8: 18,682,309 (GRCm39) E482G probably benign Het
Mme G A 3: 63,256,066 (GRCm39) E509K probably damaging Het
Mrgbp A G 2: 180,227,276 (GRCm39) T204A probably damaging Het
Mycbp2 A T 14: 103,528,769 (GRCm39) F430I probably damaging Het
Myo6 A G 9: 80,125,002 (GRCm39) D27G probably damaging Het
Ncoa6 A G 2: 155,248,597 (GRCm39) L1569S probably damaging Het
Ndc1 T A 4: 107,237,901 (GRCm39) F235Y possibly damaging Het
Nmur2 A T 11: 55,923,835 (GRCm39) S240T probably benign Het
Or14c44 T A 7: 86,061,934 (GRCm39) Y121* probably null Het
Or52ae7 G A 7: 103,120,121 (GRCm39) V292M probably damaging Het
Or5d46 A T 2: 88,170,757 (GRCm39) I283F possibly damaging Het
Osbpl1a G T 18: 12,974,249 (GRCm39) A62E probably damaging Het
Osbpl1a A C 18: 13,025,319 (GRCm39) S333A probably benign Het
Otud4 C T 8: 80,390,737 (GRCm39) T417I probably benign Het
Pagr1a T C 7: 126,614,614 (GRCm39) E197G probably damaging Het
Pcdh18 T C 3: 49,699,426 (GRCm39) Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,864,690 (GRCm39) I162L probably benign Het
Pdpr T A 8: 111,850,448 (GRCm39) Y462N probably damaging Het
Pkhd1 A T 1: 20,593,366 (GRCm39) H1582Q probably damaging Het
Polr1b A G 2: 128,952,028 (GRCm39) K352R probably damaging Het
Poteg G A 8: 27,938,065 (GRCm39) V12M probably damaging Het
Pou2f1 A C 1: 165,742,731 (GRCm39) V54G probably damaging Het
Ppme1 A G 7: 99,994,182 (GRCm39) L177P probably damaging Het
Prkce A G 17: 86,927,376 (GRCm39) D550G probably damaging Het
Prrc2c A G 1: 162,508,327 (GRCm39) probably null Het
Ptpn22 A G 3: 103,789,455 (GRCm39) probably null Het
Rabif G A 1: 134,433,943 (GRCm39) V86M probably damaging Het
Rbm25 T A 12: 83,715,281 (GRCm39) M484K probably benign Het
Rcn2 G A 9: 55,964,713 (GRCm39) A224T probably benign Het
Rexo5 T A 7: 119,433,626 (GRCm39) probably null Het
Rnase1 A T 14: 51,383,219 (GRCm39) I45N probably benign Het
Rnmt T A 18: 68,439,186 (GRCm39) D98E possibly damaging Het
Rprd2 A G 3: 95,692,371 (GRCm39) F188L probably damaging Het
Scube2 G A 7: 109,409,944 (GRCm39) T643M probably damaging Het
Skic3 T C 13: 76,333,319 (GRCm39) W25R probably damaging Het
Slc7a15 T C 12: 8,589,344 (GRCm39) I68V probably benign Het
Slco1a5 A T 6: 142,187,851 (GRCm39) V496D possibly damaging Het
Slitrk6 T G 14: 110,988,649 (GRCm39) S353R possibly damaging Het
Smpd5 T A 15: 76,179,325 (GRCm39) I53K possibly damaging Het
Tas2r108 T C 6: 40,471,021 (GRCm39) S166P probably benign Het
Tcstv7a T A 13: 120,289,951 (GRCm39) M82L probably benign Het
Tecpr1 C A 5: 144,151,162 (GRCm39) V245L possibly damaging Het
Tenm3 G T 8: 48,689,799 (GRCm39) N1929K probably damaging Het
Tigd5 T G 15: 75,782,874 (GRCm39) F412C probably damaging Het
Timm17a A T 1: 135,233,926 (GRCm39) S74T possibly damaging Het
Tmem132d T C 5: 127,873,064 (GRCm39) E515G possibly damaging Het
Tmem65 T C 15: 58,666,246 (GRCm39) N115S probably benign Het
Trmt5 C A 12: 73,328,426 (GRCm39) R259L possibly damaging Het
Trmt9b T C 8: 36,979,195 (GRCm39) V266A probably benign Het
Vmn2r50 A T 7: 9,784,016 (GRCm39) W153R probably benign Het
Vwa3a T G 7: 120,367,396 (GRCm39) S184A probably benign Het
Zbtb25 A G 12: 76,395,938 (GRCm39) L428P possibly damaging Het
Zbtb49 C T 5: 38,358,160 (GRCm39) D698N probably damaging Het
Zbtb8os T G 4: 129,234,528 (GRCm39) D35E probably damaging Het
Zfp316 T C 5: 143,250,246 (GRCm39) T56A unknown Het
Zfp334 A T 2: 165,222,407 (GRCm39) C545* probably null Het
Zmiz1 C A 14: 25,645,280 (GRCm39) S247R probably damaging Het
Zscan18 A G 7: 12,509,308 (GRCm39) probably benign Het
Zzef1 T C 11: 72,791,463 (GRCm39) V2189A probably damaging Het
Other mutations in Tle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tle1 APN 4 72,087,355 (GRCm39) missense possibly damaging 0.94
IGL00972:Tle1 APN 4 72,040,637 (GRCm39) missense probably damaging 1.00
IGL01548:Tle1 APN 4 72,088,955 (GRCm39) missense probably damaging 1.00
IGL01737:Tle1 APN 4 72,116,058 (GRCm39) splice site probably benign
IGL01798:Tle1 APN 4 72,055,385 (GRCm39) missense probably damaging 1.00
IGL01943:Tle1 APN 4 72,040,639 (GRCm39) missense probably damaging 1.00
BB006:Tle1 UTSW 4 72,118,239 (GRCm39) missense possibly damaging 0.50
BB016:Tle1 UTSW 4 72,118,239 (GRCm39) missense possibly damaging 0.50
PIT4515001:Tle1 UTSW 4 72,117,556 (GRCm39) missense possibly damaging 0.47
R0140:Tle1 UTSW 4 72,038,422 (GRCm39) missense probably damaging 1.00
R0544:Tle1 UTSW 4 72,043,227 (GRCm39) missense probably damaging 1.00
R0603:Tle1 UTSW 4 72,036,584 (GRCm39) missense probably damaging 1.00
R0729:Tle1 UTSW 4 72,044,679 (GRCm39) splice site probably benign
R0786:Tle1 UTSW 4 72,117,598 (GRCm39) missense probably damaging 1.00
R0939:Tle1 UTSW 4 72,036,771 (GRCm39) missense probably damaging 1.00
R1297:Tle1 UTSW 4 72,043,075 (GRCm39) missense probably damaging 1.00
R1465:Tle1 UTSW 4 72,058,068 (GRCm39) missense probably damaging 1.00
R1465:Tle1 UTSW 4 72,058,068 (GRCm39) missense probably damaging 1.00
R1512:Tle1 UTSW 4 72,059,495 (GRCm39) missense probably damaging 1.00
R1967:Tle1 UTSW 4 72,038,463 (GRCm39) missense probably damaging 1.00
R2218:Tle1 UTSW 4 72,117,556 (GRCm39) missense possibly damaging 0.47
R3713:Tle1 UTSW 4 72,044,659 (GRCm39) missense possibly damaging 0.70
R4367:Tle1 UTSW 4 72,036,400 (GRCm39) utr 3 prime probably benign
R4379:Tle1 UTSW 4 72,036,400 (GRCm39) utr 3 prime probably benign
R4380:Tle1 UTSW 4 72,036,400 (GRCm39) utr 3 prime probably benign
R4655:Tle1 UTSW 4 72,063,581 (GRCm39) missense possibly damaging 0.68
R4662:Tle1 UTSW 4 72,055,335 (GRCm39) missense possibly damaging 0.92
R4731:Tle1 UTSW 4 72,043,256 (GRCm39) missense possibly damaging 0.71
R4732:Tle1 UTSW 4 72,043,256 (GRCm39) missense possibly damaging 0.71
R4733:Tle1 UTSW 4 72,043,256 (GRCm39) missense possibly damaging 0.71
R4812:Tle1 UTSW 4 72,063,591 (GRCm39) missense probably damaging 0.98
R5066:Tle1 UTSW 4 72,076,504 (GRCm39) missense probably benign 0.24
R5288:Tle1 UTSW 4 72,060,081 (GRCm39) missense probably damaging 1.00
R5386:Tle1 UTSW 4 72,060,081 (GRCm39) missense probably damaging 1.00
R5405:Tle1 UTSW 4 72,057,208 (GRCm39) intron probably benign
R5590:Tle1 UTSW 4 72,043,208 (GRCm39) missense possibly damaging 0.91
R5762:Tle1 UTSW 4 72,038,372 (GRCm39) splice site probably null
R6617:Tle1 UTSW 4 72,059,517 (GRCm39) missense probably damaging 0.98
R6750:Tle1 UTSW 4 72,040,687 (GRCm39) missense probably damaging 1.00
R7077:Tle1 UTSW 4 72,076,612 (GRCm39) missense probably benign 0.25
R7153:Tle1 UTSW 4 72,057,298 (GRCm39) missense probably benign 0.03
R7156:Tle1 UTSW 4 72,088,953 (GRCm39) missense probably benign 0.15
R7266:Tle1 UTSW 4 72,057,924 (GRCm39) critical splice donor site probably null
R7316:Tle1 UTSW 4 72,036,529 (GRCm39) missense probably benign 0.01
R7478:Tle1 UTSW 4 72,055,349 (GRCm39) missense probably damaging 0.96
R7523:Tle1 UTSW 4 72,063,655 (GRCm39) missense possibly damaging 0.94
R7736:Tle1 UTSW 4 72,117,571 (GRCm39) missense probably damaging 1.00
R7862:Tle1 UTSW 4 72,117,552 (GRCm39) missense probably damaging 1.00
R7863:Tle1 UTSW 4 72,059,529 (GRCm39) missense probably null 0.68
R7929:Tle1 UTSW 4 72,118,239 (GRCm39) missense possibly damaging 0.50
R8074:Tle1 UTSW 4 72,057,216 (GRCm39) frame shift probably null
R8233:Tle1 UTSW 4 72,043,181 (GRCm39) missense probably benign 0.11
R8315:Tle1 UTSW 4 72,044,428 (GRCm39) nonsense probably null
R8350:Tle1 UTSW 4 72,057,203 (GRCm39) intron probably benign
R8494:Tle1 UTSW 4 72,043,241 (GRCm39) missense possibly damaging 0.90
R8512:Tle1 UTSW 4 72,040,670 (GRCm39) missense possibly damaging 0.64
R8919:Tle1 UTSW 4 72,076,525 (GRCm39) missense possibly damaging 0.94
R9171:Tle1 UTSW 4 72,043,232 (GRCm39) missense possibly damaging 0.50
R9192:Tle1 UTSW 4 72,036,753 (GRCm39) missense probably benign 0.12
R9391:Tle1 UTSW 4 72,116,159 (GRCm39) missense probably damaging 1.00
R9452:Tle1 UTSW 4 72,040,596 (GRCm39) missense probably benign 0.41
R9481:Tle1 UTSW 4 72,044,504 (GRCm39) missense probably damaging 0.96
R9497:Tle1 UTSW 4 72,071,135 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCTTCACATTCAGGGG -3'
(R):5'- TCACTCACAAGTTAATGCTGTCG -3'

Sequencing Primer
(F):5'- TTCACATTCAGGGGCAAACTGTC -3'
(R):5'- CTCACAAGTTAATGCTGTCGACATTG -3'
Posted On 2016-10-26