Incidental Mutation 'R5579:Akap9'
ID 438258
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase anchor protein 9
Synonyms mei2-5, repro12, AKAP450, G1-448-15, 5730481H23Rik
MMRRC Submission 043267-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.436) question?
Stock # R5579 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 3977410-4130204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 4114714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 114 (G114D)
Ref Sequence ENSEMBL: ENSMUSP00000135836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000176863]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: G3331D

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: G3331D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147629
Predicted Effect possibly damaging
Transcript: ENSMUST00000176863
AA Change: G114D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135836
Gene: ENSMUSG00000040407
AA Change: G114D

DomainStartEndE-ValueType
coiled coil region 1 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197366
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G T 17: 24,595,703 (GRCm39) C352F probably damaging Het
Abce1 A T 8: 80,427,215 (GRCm39) I237N possibly damaging Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam8 T A 7: 139,568,897 (GRCm39) Y201F probably benign Het
Adgrf1 T A 17: 43,621,955 (GRCm39) C731S probably damaging Het
Akap8l A T 17: 32,540,916 (GRCm39) I529N probably damaging Het
Alox12b T A 11: 69,053,758 (GRCm39) D158E probably benign Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Ankrd42 T C 7: 92,239,390 (GRCm39) Y466C possibly damaging Het
Apobr T C 7: 126,186,847 (GRCm39) I786T probably benign Het
Arhgef12 C T 9: 42,921,489 (GRCm39) G329R probably benign Het
Btnl1 T C 17: 34,600,526 (GRCm39) probably null Het
Ccdc174 A G 6: 91,858,331 (GRCm39) probably null Het
Ccdc183 T C 2: 25,505,434 (GRCm39) D177G possibly damaging Het
Cd14 A G 18: 36,859,288 (GRCm39) Y56H probably benign Het
Cep162 G A 9: 87,085,724 (GRCm39) A1200V probably benign Het
Clic3 T C 2: 25,348,319 (GRCm39) L128P probably damaging Het
Cntnap5b A T 1: 100,311,120 (GRCm39) R538* probably null Het
Cntnap5b A T 1: 100,311,124 (GRCm39) Q539L probably benign Het
Coq7 A T 7: 118,116,558 (GRCm39) N214K unknown Het
Cramp1 G A 17: 25,192,087 (GRCm39) H1018Y possibly damaging Het
Crtac1 T A 19: 42,293,245 (GRCm39) D288V probably damaging Het
Dab2ip C T 2: 35,605,339 (GRCm39) R132* probably null Het
Dis3l C A 9: 64,238,117 (GRCm39) C125F probably benign Het
Dnmt1 A T 9: 20,831,501 (GRCm39) V543D probably damaging Het
Dock9 A T 14: 121,837,107 (GRCm39) L67Q probably damaging Het
Ehbp1 A T 11: 22,087,846 (GRCm39) S413T probably damaging Het
Endov A G 11: 119,395,923 (GRCm39) I158V probably benign Het
Epb41l4b A G 4: 57,064,802 (GRCm39) V469A possibly damaging Het
Etf1 G A 18: 35,046,654 (GRCm39) P119S probably damaging Het
Fam135a A G 1: 24,068,808 (GRCm39) L491P possibly damaging Het
Fancd2 A T 6: 113,537,012 (GRCm39) probably null Het
Fank1 T A 7: 133,471,058 (GRCm39) probably null Het
Fbh1 A G 2: 11,753,804 (GRCm39) I846T probably damaging Het
Gas2l3 T C 10: 89,249,928 (GRCm39) T397A probably benign Het
Gga1 T C 15: 78,777,388 (GRCm39) V513A probably damaging Het
Ggt1 T C 10: 75,421,782 (GRCm39) V543A probably damaging Het
Gm11596 A T 11: 99,683,717 (GRCm39) C134* probably null Het
Gnal C T 18: 67,221,842 (GRCm39) R82C unknown Het
Hat1 T C 2: 71,240,582 (GRCm39) V92A possibly damaging Het
Icosl C T 10: 77,909,597 (GRCm39) R181C probably damaging Het
Ift46 A G 9: 44,698,160 (GRCm39) M208V possibly damaging Het
Ighv1-26 T C 12: 114,752,219 (GRCm39) K42E possibly damaging Het
Ipo5 A G 14: 121,176,025 (GRCm39) K617E probably benign Het
Irx5 A G 8: 93,086,541 (GRCm39) D208G probably benign Het
Itgal T G 7: 126,906,101 (GRCm39) V397G probably benign Het
Itpr2 G A 6: 146,074,864 (GRCm39) R2297* probably null Het
Itpr3 A G 17: 27,332,493 (GRCm39) D1779G probably damaging Het
Khdc4 T C 3: 88,607,582 (GRCm39) S345P probably benign Het
Krt4 T A 15: 101,829,669 (GRCm39) E286D probably benign Het
Loxl4 C T 19: 42,592,729 (GRCm39) G317E probably damaging Het
Mapk6 T G 9: 75,295,344 (GRCm39) H718P possibly damaging Het
Mark2 A C 19: 7,260,181 (GRCm39) V14G probably damaging Het
Mbd5 A G 2: 49,162,826 (GRCm39) T1103A possibly damaging Het
Mcph1 A G 8: 18,682,309 (GRCm39) E482G probably benign Het
Mme G A 3: 63,256,066 (GRCm39) E509K probably damaging Het
Mrgbp A G 2: 180,227,276 (GRCm39) T204A probably damaging Het
Mycbp2 A T 14: 103,528,769 (GRCm39) F430I probably damaging Het
Myo6 A G 9: 80,125,002 (GRCm39) D27G probably damaging Het
Ncoa6 A G 2: 155,248,597 (GRCm39) L1569S probably damaging Het
Ndc1 T A 4: 107,237,901 (GRCm39) F235Y possibly damaging Het
Nmur2 A T 11: 55,923,835 (GRCm39) S240T probably benign Het
Or14c44 T A 7: 86,061,934 (GRCm39) Y121* probably null Het
Or52ae7 G A 7: 103,120,121 (GRCm39) V292M probably damaging Het
Or5d46 A T 2: 88,170,757 (GRCm39) I283F possibly damaging Het
Osbpl1a G T 18: 12,974,249 (GRCm39) A62E probably damaging Het
Osbpl1a A C 18: 13,025,319 (GRCm39) S333A probably benign Het
Otud4 C T 8: 80,390,737 (GRCm39) T417I probably benign Het
Pagr1a T C 7: 126,614,614 (GRCm39) E197G probably damaging Het
Pcdh18 T C 3: 49,699,426 (GRCm39) Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,864,690 (GRCm39) I162L probably benign Het
Pdpr T A 8: 111,850,448 (GRCm39) Y462N probably damaging Het
Pkhd1 A T 1: 20,593,366 (GRCm39) H1582Q probably damaging Het
Polr1b A G 2: 128,952,028 (GRCm39) K352R probably damaging Het
Poteg G A 8: 27,938,065 (GRCm39) V12M probably damaging Het
Pou2f1 A C 1: 165,742,731 (GRCm39) V54G probably damaging Het
Ppme1 A G 7: 99,994,182 (GRCm39) L177P probably damaging Het
Prkce A G 17: 86,927,376 (GRCm39) D550G probably damaging Het
Prrc2c A G 1: 162,508,327 (GRCm39) probably null Het
Ptpn22 A G 3: 103,789,455 (GRCm39) probably null Het
Rabif G A 1: 134,433,943 (GRCm39) V86M probably damaging Het
Rbm25 T A 12: 83,715,281 (GRCm39) M484K probably benign Het
Rcn2 G A 9: 55,964,713 (GRCm39) A224T probably benign Het
Rexo5 T A 7: 119,433,626 (GRCm39) probably null Het
Rnase1 A T 14: 51,383,219 (GRCm39) I45N probably benign Het
Rnmt T A 18: 68,439,186 (GRCm39) D98E possibly damaging Het
Rprd2 A G 3: 95,692,371 (GRCm39) F188L probably damaging Het
Scube2 G A 7: 109,409,944 (GRCm39) T643M probably damaging Het
Skic3 T C 13: 76,333,319 (GRCm39) W25R probably damaging Het
Slc7a15 T C 12: 8,589,344 (GRCm39) I68V probably benign Het
Slco1a5 A T 6: 142,187,851 (GRCm39) V496D possibly damaging Het
Slitrk6 T G 14: 110,988,649 (GRCm39) S353R possibly damaging Het
Smpd5 T A 15: 76,179,325 (GRCm39) I53K possibly damaging Het
Tas2r108 T C 6: 40,471,021 (GRCm39) S166P probably benign Het
Tcstv7a T A 13: 120,289,951 (GRCm39) M82L probably benign Het
Tecpr1 C A 5: 144,151,162 (GRCm39) V245L possibly damaging Het
Tenm3 G T 8: 48,689,799 (GRCm39) N1929K probably damaging Het
Tigd5 T G 15: 75,782,874 (GRCm39) F412C probably damaging Het
Timm17a A T 1: 135,233,926 (GRCm39) S74T possibly damaging Het
Tle1 A T 4: 72,058,045 (GRCm39) L60Q probably damaging Het
Tmem132d T C 5: 127,873,064 (GRCm39) E515G possibly damaging Het
Tmem65 T C 15: 58,666,246 (GRCm39) N115S probably benign Het
Trmt5 C A 12: 73,328,426 (GRCm39) R259L possibly damaging Het
Trmt9b T C 8: 36,979,195 (GRCm39) V266A probably benign Het
Vmn2r50 A T 7: 9,784,016 (GRCm39) W153R probably benign Het
Vwa3a T G 7: 120,367,396 (GRCm39) S184A probably benign Het
Zbtb25 A G 12: 76,395,938 (GRCm39) L428P possibly damaging Het
Zbtb49 C T 5: 38,358,160 (GRCm39) D698N probably damaging Het
Zbtb8os T G 4: 129,234,528 (GRCm39) D35E probably damaging Het
Zfp316 T C 5: 143,250,246 (GRCm39) T56A unknown Het
Zfp334 A T 2: 165,222,407 (GRCm39) C545* probably null Het
Zmiz1 C A 14: 25,645,280 (GRCm39) S247R probably damaging Het
Zscan18 A G 7: 12,509,308 (GRCm39) probably benign Het
Zzef1 T C 11: 72,791,463 (GRCm39) V2189A probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4,096,639 (GRCm39) missense probably damaging 0.97
IGL00642:Akap9 APN 5 4,010,842 (GRCm39) missense probably damaging 0.99
IGL00786:Akap9 APN 5 4,120,522 (GRCm39) missense probably damaging 1.00
IGL00788:Akap9 APN 5 4,110,480 (GRCm39) missense probably damaging 1.00
IGL00969:Akap9 APN 5 4,051,550 (GRCm39) missense probably benign
IGL01014:Akap9 APN 5 4,018,683 (GRCm39) missense probably benign 0.41
IGL01302:Akap9 APN 5 4,020,711 (GRCm39) missense probably benign 0.27
IGL01610:Akap9 APN 5 4,082,839 (GRCm39) missense possibly damaging 0.95
IGL01620:Akap9 APN 5 4,010,218 (GRCm39) missense probably benign 0.11
IGL01862:Akap9 APN 5 4,115,856 (GRCm39) missense probably damaging 0.99
IGL01862:Akap9 APN 5 4,001,705 (GRCm39) missense probably damaging 0.99
IGL02151:Akap9 APN 5 4,082,728 (GRCm39) nonsense probably null
IGL02635:Akap9 APN 5 4,120,500 (GRCm39) missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4,119,130 (GRCm39) missense possibly damaging 0.88
IGL02967:Akap9 APN 5 4,026,164 (GRCm39) missense probably benign 0.07
IGL03064:Akap9 APN 5 4,018,755 (GRCm39) missense probably damaging 1.00
IGL03289:Akap9 APN 5 4,127,261 (GRCm39) missense probably damaging 1.00
Andy UTSW 5 4,011,764 (GRCm39) nonsense probably null
blimey UTSW 5 4,120,397 (GRCm39) nonsense probably null
hoarder UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
marinarum UTSW 5 4,063,875 (GRCm39) nonsense probably null
miser UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
naviculus UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
thrifty UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
wee_one UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
FR4449:Akap9 UTSW 5 4,031,214 (GRCm39) unclassified probably benign
PIT1430001:Akap9 UTSW 5 4,079,849 (GRCm39) missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4,096,221 (GRCm39) missense probably benign 0.24
R0088:Akap9 UTSW 5 4,011,946 (GRCm39) missense probably benign 0.22
R0309:Akap9 UTSW 5 4,119,038 (GRCm39) missense probably benign 0.01
R0387:Akap9 UTSW 5 4,001,678 (GRCm39) splice site probably benign
R0440:Akap9 UTSW 5 4,114,569 (GRCm39) missense probably damaging 0.99
R0441:Akap9 UTSW 5 4,011,714 (GRCm39) missense probably benign 0.15
R0491:Akap9 UTSW 5 4,022,851 (GRCm39) unclassified probably benign
R0501:Akap9 UTSW 5 4,020,685 (GRCm39) missense probably damaging 1.00
R0507:Akap9 UTSW 5 4,119,043 (GRCm39) missense probably benign 0.41
R0544:Akap9 UTSW 5 4,119,185 (GRCm39) missense probably benign 0.22
R0581:Akap9 UTSW 5 4,100,620 (GRCm39) missense probably benign 0.03
R0611:Akap9 UTSW 5 4,004,870 (GRCm39) missense probably benign 0.00
R0620:Akap9 UTSW 5 4,114,136 (GRCm39) missense probably damaging 0.98
R0639:Akap9 UTSW 5 4,110,318 (GRCm39) missense probably damaging 1.00
R0932:Akap9 UTSW 5 4,096,492 (GRCm39) missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4,114,742 (GRCm39) splice site probably null
R1101:Akap9 UTSW 5 4,096,205 (GRCm39) missense probably benign 0.00
R1159:Akap9 UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
R1170:Akap9 UTSW 5 4,105,671 (GRCm39) missense probably benign
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1453:Akap9 UTSW 5 4,025,614 (GRCm39) splice site probably null
R1551:Akap9 UTSW 5 4,119,174 (GRCm39) missense probably benign 0.02
R1608:Akap9 UTSW 5 4,011,783 (GRCm39) missense probably damaging 1.00
R1652:Akap9 UTSW 5 4,127,210 (GRCm39) missense probably damaging 1.00
R1659:Akap9 UTSW 5 4,114,633 (GRCm39) missense probably damaging 1.00
R1713:Akap9 UTSW 5 4,089,345 (GRCm39) critical splice donor site probably null
R1719:Akap9 UTSW 5 4,007,645 (GRCm39) nonsense probably null
R1720:Akap9 UTSW 5 4,022,791 (GRCm39) missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4,051,667 (GRCm39) missense probably benign 0.41
R1872:Akap9 UTSW 5 4,051,406 (GRCm39) missense probably damaging 1.00
R1876:Akap9 UTSW 5 4,011,809 (GRCm39) missense probably benign 0.28
R1881:Akap9 UTSW 5 4,100,173 (GRCm39) missense probably benign
R1950:Akap9 UTSW 5 4,010,677 (GRCm39) missense probably damaging 1.00
R1980:Akap9 UTSW 5 4,022,771 (GRCm39) missense probably damaging 0.99
R1993:Akap9 UTSW 5 4,088,520 (GRCm39) splice site probably null
R2008:Akap9 UTSW 5 4,010,131 (GRCm39) missense possibly damaging 0.47
R2020:Akap9 UTSW 5 4,011,967 (GRCm39) missense probably damaging 1.00
R2051:Akap9 UTSW 5 4,025,685 (GRCm39) nonsense probably null
R2061:Akap9 UTSW 5 4,011,010 (GRCm39) missense probably damaging 1.00
R2109:Akap9 UTSW 5 4,094,847 (GRCm39) missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4,114,509 (GRCm39) missense probably damaging 1.00
R2225:Akap9 UTSW 5 4,127,271 (GRCm39) missense probably damaging 0.96
R2232:Akap9 UTSW 5 4,096,603 (GRCm39) missense probably damaging 1.00
R2424:Akap9 UTSW 5 4,115,279 (GRCm39) missense probably damaging 0.97
R2483:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R2879:Akap9 UTSW 5 4,026,353 (GRCm39) intron probably benign
R3622:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3623:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3624:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4,120,351 (GRCm39) missense probably damaging 1.00
R3806:Akap9 UTSW 5 4,004,410 (GRCm39) missense probably benign 0.00
R3919:Akap9 UTSW 5 4,011,764 (GRCm39) nonsense probably null
R4023:Akap9 UTSW 5 4,042,077 (GRCm39) missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4,093,996 (GRCm39) missense probably damaging 0.99
R4434:Akap9 UTSW 5 4,082,708 (GRCm39) missense probably damaging 0.99
R4529:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4530:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4532:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4533:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4585:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4586:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4655:Akap9 UTSW 5 4,096,403 (GRCm39) missense probably benign 0.14
R4676:Akap9 UTSW 5 4,114,515 (GRCm39) nonsense probably null
R4676:Akap9 UTSW 5 4,082,774 (GRCm39) missense probably damaging 1.00
R4724:Akap9 UTSW 5 4,105,339 (GRCm39) missense probably benign
R4731:Akap9 UTSW 5 4,012,266 (GRCm39) missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4733:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4743:Akap9 UTSW 5 4,011,013 (GRCm39) missense probably damaging 1.00
R4749:Akap9 UTSW 5 4,018,737 (GRCm39) missense probably benign 0.41
R4756:Akap9 UTSW 5 4,051,418 (GRCm39) missense probably damaging 0.99
R4757:Akap9 UTSW 5 4,058,382 (GRCm39) missense probably damaging 1.00
R4860:Akap9 UTSW 5 4,084,916 (GRCm39) intron probably benign
R4937:Akap9 UTSW 5 4,100,145 (GRCm39) splice site probably null
R4960:Akap9 UTSW 5 4,007,664 (GRCm39) missense probably benign 0.15
R4974:Akap9 UTSW 5 4,011,466 (GRCm39) missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4,051,748 (GRCm39) missense probably damaging 0.96
R5160:Akap9 UTSW 5 4,080,007 (GRCm39) missense probably damaging 1.00
R5200:Akap9 UTSW 5 4,010,734 (GRCm39) missense probably benign 0.00
R5245:Akap9 UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
R5293:Akap9 UTSW 5 3,998,687 (GRCm39) missense probably damaging 0.99
R5408:Akap9 UTSW 5 4,108,458 (GRCm39) missense possibly damaging 0.84
R5507:Akap9 UTSW 5 4,018,683 (GRCm39) missense probably benign 0.41
R5517:Akap9 UTSW 5 4,051,665 (GRCm39) missense possibly damaging 0.76
R5619:Akap9 UTSW 5 4,004,760 (GRCm39) intron probably benign
R5645:Akap9 UTSW 5 4,100,590 (GRCm39) missense probably benign 0.09
R5669:Akap9 UTSW 5 4,100,540 (GRCm39) nonsense probably null
R5686:Akap9 UTSW 5 4,021,926 (GRCm39) missense probably benign 0.00
R5697:Akap9 UTSW 5 4,010,170 (GRCm39) missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
R5875:Akap9 UTSW 5 4,127,285 (GRCm39) missense probably benign 0.01
R5897:Akap9 UTSW 5 4,127,904 (GRCm39) missense probably benign 0.23
R5999:Akap9 UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
R6025:Akap9 UTSW 5 4,082,801 (GRCm39) missense probably damaging 1.00
R6078:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6138:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6225:Akap9 UTSW 5 4,012,105 (GRCm39) missense probably damaging 1.00
R6243:Akap9 UTSW 5 4,115,000 (GRCm39) splice site probably null
R6326:Akap9 UTSW 5 4,012,061 (GRCm39) missense probably damaging 1.00
R6564:Akap9 UTSW 5 4,078,491 (GRCm39) missense probably damaging 0.98
R6617:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6625:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6632:Akap9 UTSW 5 4,063,842 (GRCm39) splice site probably null
R6677:Akap9 UTSW 5 4,079,869 (GRCm39) missense probably benign 0.21
R6717:Akap9 UTSW 5 4,114,086 (GRCm39) missense probably damaging 1.00
R6893:Akap9 UTSW 5 4,011,709 (GRCm39) missense probably benign 0.32
R6915:Akap9 UTSW 5 4,010,551 (GRCm39) missense probably benign 0.03
R6938:Akap9 UTSW 5 4,096,628 (GRCm39) missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4,115,866 (GRCm39) missense possibly damaging 0.65
R7032:Akap9 UTSW 5 4,004,896 (GRCm39) missense probably benign
R7164:Akap9 UTSW 5 4,110,364 (GRCm39) missense probably damaging 0.96
R7170:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7192:Akap9 UTSW 5 4,055,723 (GRCm39) splice site probably null
R7284:Akap9 UTSW 5 4,006,246 (GRCm39) missense probably damaging 1.00
R7299:Akap9 UTSW 5 4,082,696 (GRCm39) missense probably damaging 1.00
R7313:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7326:Akap9 UTSW 5 4,095,930 (GRCm39) missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4,096,364 (GRCm39) missense probably damaging 0.99
R7455:Akap9 UTSW 5 4,022,792 (GRCm39) missense probably benign 0.03
R7482:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7489:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7525:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7528:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7576:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7577:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7578:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7610:Akap9 UTSW 5 4,007,677 (GRCm39) missense possibly damaging 0.95
R7658:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7754:Akap9 UTSW 5 4,096,736 (GRCm39) missense probably benign 0.03
R7818:Akap9 UTSW 5 4,063,875 (GRCm39) nonsense probably null
R7979:Akap9 UTSW 5 4,100,381 (GRCm39) missense probably benign
R7991:Akap9 UTSW 5 4,114,949 (GRCm39) splice site probably null
R8036:Akap9 UTSW 5 4,120,397 (GRCm39) nonsense probably null
R8054:Akap9 UTSW 5 4,088,707 (GRCm39) critical splice donor site probably null
R8116:Akap9 UTSW 5 4,111,183 (GRCm39) missense probably benign 0.04
R8150:Akap9 UTSW 5 4,011,982 (GRCm39) missense probably damaging 1.00
R8234:Akap9 UTSW 5 4,094,845 (GRCm39) missense probably benign 0.18
R8348:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8365:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8366:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8448:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8466:Akap9 UTSW 5 4,088,659 (GRCm39) missense probably damaging 1.00
R8772:Akap9 UTSW 5 4,096,255 (GRCm39) missense probably damaging 1.00
R8881:Akap9 UTSW 5 4,011,279 (GRCm39) missense
R8937:Akap9 UTSW 5 4,094,048 (GRCm39) missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3,998,805 (GRCm39) missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4,105,650 (GRCm39) missense probably benign
R9049:Akap9 UTSW 5 4,114,597 (GRCm39) missense
R9074:Akap9 UTSW 5 4,127,959 (GRCm39) missense probably benign 0.40
R9124:Akap9 UTSW 5 4,111,284 (GRCm39) missense probably damaging 0.99
R9129:Akap9 UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
R9371:Akap9 UTSW 5 4,011,852 (GRCm39) missense possibly damaging 0.83
R9424:Akap9 UTSW 5 4,012,224 (GRCm39) nonsense probably null
R9424:Akap9 UTSW 5 4,012,223 (GRCm39) nonsense probably null
R9509:Akap9 UTSW 5 4,096,349 (GRCm39) missense probably benign
R9515:Akap9 UTSW 5 4,105,709 (GRCm39) missense probably damaging 1.00
R9567:Akap9 UTSW 5 4,127,311 (GRCm39) missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4,119,149 (GRCm39) missense probably damaging 1.00
R9619:Akap9 UTSW 5 4,094,833 (GRCm39) missense probably damaging 1.00
R9635:Akap9 UTSW 5 4,100,545 (GRCm39) missense probably benign 0.20
R9680:Akap9 UTSW 5 4,011,587 (GRCm39) missense probably benign 0.03
R9691:Akap9 UTSW 5 4,010,491 (GRCm39) missense probably damaging 1.00
R9726:Akap9 UTSW 5 4,053,757 (GRCm39) missense probably benign 0.39
U15987:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
X0026:Akap9 UTSW 5 4,064,039 (GRCm39) missense probably damaging 1.00
X0057:Akap9 UTSW 5 4,025,598 (GRCm39) critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 4,012,251 (GRCm39) missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4,096,189 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCATCAGAAGACACTGCAG -3'
(R):5'- GGCAGATTTGGATGTCACAC -3'

Sequencing Primer
(F):5'- GAGGCAAACACCCAGGGC -3'
(R):5'- TTGGATGTCACACACAGTTTTG -3'
Posted On 2016-10-26