Incidental Mutation 'R5579:Akap9'
ID438258
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 043267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R5579 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4064714 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 114 (G114D)
Ref Sequence ENSEMBL: ENSMUSP00000135836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000176863]
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: G3331D

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: G3331D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147629
Predicted Effect possibly damaging
Transcript: ENSMUST00000176863
AA Change: G114D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135836
Gene: ENSMUSG00000040407
AA Change: G114D

DomainStartEndE-ValueType
coiled coil region 1 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197366
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,700,275 S345P probably benign Het
6430573F11Rik T C 8: 36,512,041 V266A probably benign Het
Abca3 G T 17: 24,376,729 C352F probably damaging Het
Abce1 A T 8: 79,700,586 I237N possibly damaging Het
Acrbp A G 6: 125,061,099 D421G probably benign Het
Adam8 T A 7: 139,988,984 Y201F probably benign Het
Adgrf1 T A 17: 43,311,064 C731S probably damaging Het
AF067063 T A 13: 119,828,415 M82L probably benign Het
Akap8l A T 17: 32,321,942 I529N probably damaging Het
Alox12b T A 11: 69,162,932 D158E probably benign Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Ankrd42 T C 7: 92,590,182 Y466C possibly damaging Het
Apobr T C 7: 126,587,675 I786T probably benign Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Btnl1 T C 17: 34,381,552 probably null Het
Ccdc174 A G 6: 91,881,350 probably null Het
Ccdc183 T C 2: 25,615,422 D177G possibly damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cep162 G A 9: 87,203,671 A1200V probably benign Het
Clic3 T C 2: 25,458,307 L128P probably damaging Het
Cntnap5b A T 1: 100,383,395 R538* probably null Het
Cntnap5b A T 1: 100,383,399 Q539L probably benign Het
Coq7 A T 7: 118,517,335 N214K unknown Het
Cramp1l G A 17: 24,973,113 H1018Y possibly damaging Het
Crtac1 T A 19: 42,304,806 D288V probably damaging Het
Dab2ip C T 2: 35,715,327 R132* probably null Het
Dis3l C A 9: 64,330,835 C125F probably benign Het
Dnmt1 A T 9: 20,920,205 V543D probably damaging Het
Dock9 A T 14: 121,599,695 L67Q probably damaging Het
Ehbp1 A T 11: 22,137,846 S413T probably damaging Het
Endov A G 11: 119,505,097 I158V probably benign Het
Epb41l4b A G 4: 57,064,802 V469A possibly damaging Het
Etf1 G A 18: 34,913,601 P119S probably damaging Het
Fam135a A G 1: 24,029,727 L491P possibly damaging Het
Fancd2 A T 6: 113,560,051 probably null Het
Fank1 T A 7: 133,869,329 probably null Het
Fbxo18 A G 2: 11,748,993 I846T probably damaging Het
Gas2l3 T C 10: 89,414,066 T397A probably benign Het
Gga1 T C 15: 78,893,188 V513A probably damaging Het
Ggt1 T C 10: 75,585,948 V543A probably damaging Het
Gm11596 A T 11: 99,792,891 C134* probably null Het
Gnal C T 18: 67,088,771 R82C unknown Het
Hat1 T C 2: 71,410,238 V92A possibly damaging Het
Icosl C T 10: 78,073,763 R181C probably damaging Het
Ift46 A G 9: 44,786,863 M208V possibly damaging Het
Ighv1-26 T C 12: 114,788,599 K42E possibly damaging Het
Ipo5 A G 14: 120,938,613 K617E probably benign Het
Irx5 A G 8: 92,359,913 D208G probably benign Het
Itgal T G 7: 127,306,929 V397G probably benign Het
Itpr2 G A 6: 146,173,366 R2297* probably null Het
Itpr3 A G 17: 27,113,519 D1779G probably damaging Het
Krt4 T A 15: 101,921,234 E286D probably benign Het
Loxl4 C T 19: 42,604,290 G317E probably damaging Het
Mapk6 T G 9: 75,388,062 H718P possibly damaging Het
Mark2 A C 19: 7,282,816 V14G probably damaging Het
Mbd5 A G 2: 49,272,814 T1103A possibly damaging Het
Mcph1 A G 8: 18,632,293 E482G probably benign Het
Mme G A 3: 63,348,645 E509K probably damaging Het
Mrgbp A G 2: 180,585,483 T204A probably damaging Het
Mycbp2 A T 14: 103,291,333 F430I probably damaging Het
Myo6 A G 9: 80,217,720 D27G probably damaging Het
Ncoa6 A G 2: 155,406,677 L1569S probably damaging Het
Ndc1 T A 4: 107,380,704 F235Y possibly damaging Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Olfr1176 A T 2: 88,340,413 I283F possibly damaging Het
Olfr301 T A 7: 86,412,726 Y121* probably null Het
Olfr608 G A 7: 103,470,914 V292M probably damaging Het
Osbpl1a G T 18: 12,841,192 A62E probably damaging Het
Osbpl1a A C 18: 12,892,262 S333A probably benign Het
Otud4 C T 8: 79,664,108 T417I probably benign Het
Pagr1a T C 7: 127,015,442 E197G probably damaging Het
Pcdh18 T C 3: 49,744,977 Q1012R probably damaging Het
Pcdhgb5 A C 18: 37,731,637 I162L probably benign Het
Pdpr T A 8: 111,123,816 Y462N probably damaging Het
Pkhd1 A T 1: 20,523,142 H1582Q probably damaging Het
Polr1b A G 2: 129,110,108 K352R probably damaging Het
Poteg G A 8: 27,448,037 V12M probably damaging Het
Pou2f1 A C 1: 165,915,162 V54G probably damaging Het
Ppme1 A G 7: 100,344,975 L177P probably damaging Het
Prkce A G 17: 86,619,948 D550G probably damaging Het
Prrc2c A G 1: 162,680,758 probably null Het
Ptpn22 A G 3: 103,882,139 probably null Het
Rabif G A 1: 134,506,205 V86M probably damaging Het
Rbm25 T A 12: 83,668,507 M484K probably benign Het
Rcn2 G A 9: 56,057,429 A224T probably benign Het
Rexo5 T A 7: 119,834,403 probably null Het
Rnase1 A T 14: 51,145,762 I45N probably benign Het
Rnmt T A 18: 68,306,115 D98E possibly damaging Het
Rprd2 A G 3: 95,785,059 F188L probably damaging Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Slc7a15 T C 12: 8,539,344 I68V probably benign Het
Slco1a5 A T 6: 142,242,125 V496D possibly damaging Het
Slitrk6 T G 14: 110,751,217 S353R possibly damaging Het
Smpd5 T A 15: 76,295,125 I53K possibly damaging Het
Tas2r108 T C 6: 40,494,087 S166P probably benign Het
Tecpr1 C A 5: 144,214,344 V245L possibly damaging Het
Tenm3 G T 8: 48,236,764 N1929K probably damaging Het
Tigd5 T G 15: 75,911,025 F412C probably damaging Het
Timm17a A T 1: 135,306,188 S74T possibly damaging Het
Tle1 A T 4: 72,139,808 L60Q probably damaging Het
Tmem132d T C 5: 127,796,000 E515G possibly damaging Het
Tmem65 T C 15: 58,794,397 N115S probably benign Het
Trmt5 C A 12: 73,281,652 R259L possibly damaging Het
Ttc37 T C 13: 76,185,200 W25R probably damaging Het
Vmn2r50 A T 7: 10,050,089 W153R probably benign Het
Vwa3a T G 7: 120,768,173 S184A probably benign Het
Zbtb25 A G 12: 76,349,164 L428P possibly damaging Het
Zbtb49 C T 5: 38,200,816 D698N probably damaging Het
Zbtb8os T G 4: 129,340,735 D35E probably damaging Het
Zfp316 T C 5: 143,264,491 T56A unknown Het
Zfp334 A T 2: 165,380,487 C545* probably null Het
Zmiz1 C A 14: 25,644,856 S247R probably damaging Het
Zscan18 A G 7: 12,775,381 probably benign Het
Zzef1 T C 11: 72,900,637 V2189A probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 intron probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTCATCAGAAGACACTGCAG -3'
(R):5'- GGCAGATTTGGATGTCACAC -3'

Sequencing Primer
(F):5'- GAGGCAAACACCCAGGGC -3'
(R):5'- TTGGATGTCACACACAGTTTTG -3'
Posted On2016-10-26